Crop Science
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published online 1 May 2009
Published in Crop Sci 49:913-922 (2009)
© 2009 Crop Science Society of America
677 S. Segoe Rd., Madison, WI 53711 USA

Open Access Article
This Article
Free via Open Access
Right arrow OA Abstract
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saha, M. C.
Right arrow Articles by Hopkins, A. A.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Saha, M. C.
Right arrow Articles by Hopkins, A. A.
Agricola
Right arrow Articles by Saha, M. C.
Right arrow Articles by Hopkins, A. A.
Related Collections
Right arrow Other Forage Crops
Right arrow Plant Genetic Resources
Right arrow Crop Genetics

Genetic Variation within and among Wildrye (Elymus canadensis and E. virginicus) Populations from the Southern Great Plains

Malay C. Saha, Carolyn A. Young and Andrew A. Hopkins*

Forage Improvement Division, Samuel Roberts Noble Foundation, Inc., Ardmore, OK 73401

* Corresponding author (aahopkins{at}noble.org).


    ABSTRACT
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 
There is interest in Canada wildrye (CWR, Elymus canadensis L.) and Virginia wildrye (VWR, E. virginicus L.) for conservation and forage uses. Our objectives were to identify a set of molecular markers to assess genetic structure within and diversity among populations of CWR and VWR from the Southern Great Plains and to determine if these populations had an associated fungal endophyte. Nine CWR and five VWR populations and two barley (Hordeum vulgare L.) cultivars were genotyped using simple sequence repeat (SSR) markers isolated from tall fescue [Lolium arundinaceum (Schreb.) Darbysh.] expressed sequence tags (TF ESTs). Scorable fragments were produced by 31% of TF EST-SSRs tested, thus identifying a set of SSR markers for wildrye. Populations grouped into three clusters consisting of (i) three wild populations, one plant introduction, and two commercial sources of CWR; (ii) all VWR populations and three CWR plant introductions; and (iii) barley cultivars. Clustering indicated possible gene flow between CWR and VWR. Genetic variation within populations was minimal and comparable to that of the barley cultivars. Thus, unlike many ancestral cultivars and landraces of self-pollinated crops, CWR and VWR populations consisted of essentially pure lines and can be handled as such in a breeding program. Potentially sexual and asexual epichloë endophytes were found in several populations, indicating the need to account for endophytes in breeding and germplasm conservation efforts of wildrye.

Abbreviations: CWR, Canada wildrye • PCR, polymerase chain reaction • SSR, simple sequence repeat • TF EST, tall fescue expressed sequence tag • UPGMA, unweighted pair group method with arithmetic mean • VWR, Virginia wildrye


    INTRODUCTION
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 
CANADA WILDRYE (CWR, Elymus canadensis L.) and Virginia wildrye (VWR, E. virginicus L.) are cool-season grasses native to North America (Hitchcock and Chase, 1971). Both species are generally short-lived perennials, highly self-pollinated (Jensen et al., 1990), and tetraploid (2n = 4x = 28) with a genomic constitution of SSHH (Dewey, 1982). The S and H genomes in Elymus derive from Pseudoroegneria and Critesion (formerly Hordeum) species, respectively, based on cytogenetic (Dewey, 1984), genomic DNA (Sun et al., 1997) and chloroplast DNA evidence (McMillan and Sun, 2004). There is interest in using CWR and VWR for forage production (Schuster and de Leon Garcia, 1973; Sanderson et al., 2004a,b), conservation purposes (Bush, 2002; USDA–NRCS, 2003; Lloyd-Reilly et al., 2003), reclamation plantings (Ponder, 1979; Nord et al., 1996), and as a source of genes for improvement of other species (Dahleen, 1996; Dahleen and Joppa, 1992; Kumar and Walton, 1992; Park and Walton, 1989).

Breeding efforts with CWR and VWR have been very limited. The only known cultivar of CWR, ‘Mandan’, released in 1946 by the USDA and the North Dakota Agricultural Experiment Station, is a direct selection of a wild collection from North Dakota (Alderson and Sharp, 1994). In addition, the VWR cultivar Omaha is marketed by Stock Seed Farms of Murdock, NE. Recently, the USDA–ARS grass breeding program in Lincoln, NE, released the new CWR cultivar Homestead (K.P. Vogel, personal communications, 2008). Several "source identified" or "selected" germplasm and ecoptypes of CWR and VWR from the Midwest (USDA–NRCS, 2000; Bruckerhoff, 2002; Durling et al., 2006) and Texas (USDA–NRCS, n.d.) have been released in the past decade by the USDA–NRCS. Unnamed, nonselected germplasm of CWR, referred to in this report as "commercial source populations," are available in the seed trade.

The applicability of tall fescue [Lolium arundinaceum (Schreb.) Darbysh.] expressed sequence tag (TF EST) simple sequence repeats (SSRs) in wildrye species has not been determined. Polymerase chain reaction (PCR)–based marker systems such as randomly amplified polymorphic DNA and SSR markers have been applied to Elymus species, including CWR (Sun et al., 1997), although analysis of genetic variation within and among wildrye populations based on DNA appears to be lacking. Transcribed regions are often conserved across species and genera, so SSR markers derived from expressed sequence tags (EST-SSRs) have a tendency to be transferable. Transferability of SSR loci across species (>50%) within a genus (Thiel et al., 2003) and between genera (Eujayl et al., 2004; Saha et al., 2004) have been reported, suggesting that TF EST-SSRs could be applicable to CWR and VWR.

Genetic structure is important in determining how to handle populations in a breeding program. For instance, landraces of self-pollinating species such as wheat (Triticum aestivum L.) frequently consist of a mixture of genotypes (e.g., Ribeiro-Carvalho et al., 2004). As a consequence, early cultivar development efforts were often successful at isolating superior lines from a single landrace (Allan, 1987). Similar examples exist in other self-pollinated crops such as oat (Avena sativa L.) (Brown and Patterson, 1992) and soybean [Glycine max (L.) Merr.] (Lorenzen and Shoemaker, 1996; Fehr, 1987). Based on isozyme or allozyme data, variation within wildrye populations appears to be minimal in many (Clegg et al., 1976; Sanders et al., 1979; Díaz et al., 1998) although not all (Sanders and Hamrick, 1980) cases. Intra- and interspecific variation for CWR and VWR populations was revealed by analysis of chloroplast DNA markers (McMillan and Sun, 2004); very minor differences were observed between three of the four CWR populations examined.

Endophytes can have a number of implications when developing improved grass cultivars. In Festuca and Lolium spp., Neotyphodium endophytes can impart tolerance to biotic (Popay and Bonos, 2005) and abiotic (Malinowski et al., 2005) stresses, but they may also have detrimental effects on grazing livestock (Thompson et al., 2001; Oliver, 2005). Novel, nontoxic strains have recently been deployed in forage cultivars to eliminate animal health problems associated with endophytes (Bouton et al., 2002; Easton and Tapper, 2005). Sexual species of endophytes, including Epichloë spp., can produce stroma on the host, which arrests development of the reproductive culm, a condition known as choke disease, thus greatly reducing seed yields (Pfender and Alderman, 2006). The sexual fungal endophyte Epichloë elymi is commonly found in CWR (White and Bultman, 1987) and VWR (Leuchtmann and Clay, 1993), and more recently asexual Neotyphodium spp. have been found in wild populations of CWR (Vinton et al., 2001; Burr et al., 2007) and VWR (Moon et al., 2004). Although the impacts of endophyte infection in CWR and VWR on host fitness and grazing animal health are not known, a logical starting point in cultivar development is to determine if endophytes are present in the plant germplasm and if so, whether they may be potentially choke-forming sexual species.

The grass breeding program at the Noble Foundation (Ardmore, OK) has begun an effort to develop improved cultivars of CWR for the U.S. Southern Great Plains for forage production and conservation uses. Collections of CWR were made from the Southern Plains and evaluated for persistence under heavy grazing, and the population 98CWR8 was identified as promising for further development (Hopkins and West, 2002). We undertook this research in part to determine whether 98CWR8 and other wildrye populations consisted of single pure lines or a number of diverse genotypes. To do so, we set out to identify a set of TF EST-SSRs that could be used to characterize genetic variation within and among several possible germplasm sources (e.g., PIs, collections from the wild, commercially available seed, Virginia wildrye) that might be used in the CWR breeding program. Finally, because of the implications for the breeding program, we needed to determine whether these various germplasm sources hosted an endophyte. Thus, the objectives of this research were to identify a set of TF EST-SSRs to assess genetic structure within and diversity among populations of CWR and VWR from the Southern Great Plains and to determine if these populations had an associated epichloë endophyte.


    MATERIALS AND METHODS
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Plant Materials
A total of 70 wildrye genotypes were sampled, including five individuals from each of nine CWR and five VWR populations. Two genotypes from each of two barley (Hordeum vulgare L.) cultivars (Table 1 ) were included as controls for comparison. Wild populations were collected by Andrew Hopkins in Texas and Oklahoma from roadsides or native range sites; PIs, representative of publicly available CWR and VWR germplasm originating from the Southern Great Plains, were received from the USDA National Plant Genetic System; and the commercial source populations were purchased from Stock Seed Farms, Inc. (Murdock, NE) and Sharp Brothers Seed Co. (Healy, KS). Eight genotypes, one each from tall fescue and barley and three each from CWR and VWR, were used for the initial screening of the SSR primers. The tall fescue genotype HD28-56 was used as a control to verify amplifications results. Seeds were planted into 5- by 5- by 5-cm pots filled with a commercial potting mix (SB 100 bedding mix; SunGro Horticulture, Bellevue, WA). A soluble fertilizer solution (The Scotts Co., Marysville, OH) was used as needed to maintain vigorous growth. Plants were transferred to 4-L pots and allowed to grow under standard greenhouse conditions.


View this table:
[in this window]
[in a new window]

 
Table 1. Wildrye populations, barley cultivars, and genotypes (in parenthesis), along with their origins and seed sources examined for genetic diversity. Endophyte status of populations was determined using immunoblot and polymerase chain reaction (PCR) techniques.

 
DNA Isolation and PCR Amplification
Plant DNA was extracted using Qiagen DNeasy Plant Mini Kit (Qiagen, Valencia, CA). Approximately 200 mg of young leaf blade from each plant was collected in 2.0-mL microcentrifuge tubes. Freshly frozen leaf tissue was ground to fine powder using a Mixer Mill Type MM 300 (RETSCH, Hann, Germany). The DNeasy protocol was used with a minor modification: instead of a two-step DNA elution, we followed a one-step DNA elution with 90 µl of AE buffer in each tube. The DNA concentrations were quantified using a Hoefer Dyna Quant 200 (Amersham Biosciences, Piscataway, NJ) DNA fluorometer. Twenty nanograms of DNA were used as a template for each PCR reaction. The PCR reactions were run under standard conditions for all primers; PCR products were resolved on 6% polyacrylamide denaturing gels and visualized by silver staining, as described in Saha et al. (2004).

SSR Amplification, Fragment Scoring, and Evaluation of Polymorphism
A total of 157 primer pairs obtained from TF EST-SSRs were first screened with a subset of plants (eight genotypes) to establish primer sets that would produce amplification products across species. Selected primers were then assayed with the complete sample set of genotypes. The SSR bands were scored as present or absent, and only clear, reproducible bands were scored. Primers that produced many faint, difficult-to-score bands were considered nonspecific amplifications. The band size was reported for the most intensely amplified band for each SSR or the average of the stutter if the intensity was the same, using a 10-bp DNA ladder (Invitrogen Life Technologies, Carlsbad, CA) as the reference point. Null alleles, where a given product was not amplified, were assigned to genotypes once confirmed.

Determination of Genetic Relationship
Markers obtained from TF EST-SSRs were analyzed to construct similarity matrices among and within genotypes using NTSYS-PC 2.10 (Applied Biostatistics, Setauket, NY). Genetic similarity among genotypes was calculated using the DICE similarity coefficient (Dice, 1945) following the SIMQUAL procedure. The sequential agglomerative hierarchical and nested clustering algorithm was used to construct dendograms using the similarity coefficients. The ‘TM’ option was set to ‘FIND’ to detect all possible trees using the unweighted pair group method with arithmetic mean (UPGMA) method. The TREE procedure of the NTSYS program was used to create the dendogram. The PAUP* 4.0 program was used for bootstrap analysis. The analysis was performed using the beta program with 1000 replications following the neighbor joining algorithm (Swofford, 2002). Minimum tree retention criterion was set at 50%.

Endophyte Detection
The presence of epichloë endophytes (either the sexual Epichloë sp. or asexual Neotyphodium sp.) was detected directly in plant material using either a Neotyphodium immunoblot detection kit (Hiatt et al., 1997; Hiatt et al., 1999) or a PCR method with primers specific to all epichloë endophytes as described below.

The immunoblot procedure (Agrinostics, Inc., Watkinsville, GA) was performed following the manufacturer's instructions with stem cross-sections from each genotype collected at ground level. The stem sections were washed with double distilled sterilized water before the assay. Development of a pink color on the immunoblot membrane was considered indicative of endophyte presence.

Endophytes were cultured from surface-sterilized stem sections and allowed to grow out on potato dextrose agar media (Difco Laboratories, Detroit, MI). Genomic DNA was isolated from a pure culture following the protocol of Moon et al. (1999) with minor modifications: that is, a salt (1 M NaCl) purification step for the removal of additional polysaccharides was omitted. Endophyte DNA was tested with the TF EST-SSR primers to make sure no reproducible bands were produced with these plant primers.

To examine the endophyte status of the seed stocks, genomic DNA was isolated from 12 individual seeds of each available population using the Magattract 96 DNA plant core kit (Qiagen) as per the manufacturer's instructions. Polymerase chain reaction was used to detect endophyte genomic DNA sequences within total DNA extracted from grass seeds and from young leaf blades. The PCR was based on primers that anneal to the endophyte translation elongation factor 1-{alpha} (tef1) (tef1-exon1d, GGGTAAGGACGAAAAGACTCA and tef1-exon6u-1, CGGCAGCGATAATCAGGATAG) (Craven et al., 2001). Polymerase chain reactions were performed in either 25- or 50-µL reaction volumes containing 5 to 100 ng of DNA, 1x green reaction buffer (Promega, Madison, WI), 200 µM each dNTPs, 200 nM of each primer, 1 U GoTaq (Promega). The PCR program consisted of 94°C for 2 min followed by 35 cycles of 94°C for 15 s, 58°C for 30 s, and 72°C for 1 min. The PCR products were separated on 2% agarose in 1X Tris-borate-ethylenediaminetetraacetic acid (Invitrogen), stained with ethidium bromide and visualized under UV light. Endophyte presence was determined based on the presence of a specific PCR band. To determine the epichloë endophyte species, the amplified PCR fragments obtained from the seed samples were cloned into pGEM-Teasy (Promega) and used to transform Escherichia coli XL1 blue cells. DNA was isolated (QIAprep Spin Miniprep Kit, Qiagen) from 12 to 24 independent colonies containing the tef1 fragment from each plant–endophyte association and sequenced. In the case of 99CWR7 and 03VWR2, plants were obtained from the original collection site and used to isolate pure cultures of endophyte from which DNA was extracted for phylogenetic analysis. The sequence data were edited using Sequencher 4.8 (Gene Codes) to obtain consensus sequences. The sequences were compared to GenBank for identification, and phylogenetic analysis was performed as per Craven et al. (2001) using maximum parsimony that utilized the branch and bound search (Swofford, 2002).


    RESULTS AND DISCUSSION
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Microsatellite Profiling
In our preliminary evaluations of TF EST-SSR primers for CWR and VWR populations, 49 (31%) of the primer pairs showed clear scorable SSR-type bands. A total of 235 fragments were identified in 74 wildrye and barley genotypes using 38 TF EST-SSR primer pairs that were randomly selected from the 49 primer pairs showing clear amplifications. Number of fragments per primer pair ranged from 2 (NFFA015) to 14 (NFFA092) with an average of 6.2 fragments per primer pair (data not shown). Total number of fragments in each genotype of different populations ranged from 45 to 81 (Table 2 ). Average number of fragments in both the wildrye species (CWR 71.3 and VWR 68.3) was much higher than barley (49.5). A genotype of the CWR commercial source population Sharp's had the greatest number of fragments (81), whereas a genotype of the VWR wild population 03VWR2 had the least (60). The level of microsatellite polymorphism found for CWR and VWR plants is comparable to that reported for other grass species (Varshney et al., 2005). The present findings support previous results that TF EST-SSR markers are useful across different grass species (Saha et al., 2004). The microsatellite markers thus developed for CWR and VWR (Supplementary Table 1) will enrich the limited SSR marker resources available in these wildrye species. Detailed information on these primers including primer sequences was reported by Saha et al. (2004).


View this table:
[in this window]
[in a new window]

 
Table 2. Number of microsatellite fragments obtained in genotypes of Canada wildrye and Virginia wildrye populations and barley cultivars from 38 tall fescue expressed sequence tag–simple sequence repeats.

 
Genetic Variability
The UPGMA analysis based on SSR markers indicated that the barley cultivars were distinctly different from wildrye with only 20% similarity (data not shown). The dendogram clustered the wildrye genotypes into two distinct groups at 64% similarity. The outermost group consisted of CWR genotypes from three wild populations, one PI, and two commercial source populations. The middle group contained genotypes from three CWR PIs and all VWR populations. The results from bootstrap analysis (Fig. 1 ) generally supported the phylogenetic relationship deduced from UPGMA. In this analysis, clusters supported by less than 50% of bootstraps were collapsed into polytomies. The barley clusters were supported by 100% of bootstraps. Clustering of three wild populations, one PI, and two commercial source populations of CWR was supported by high bootstrap values (92%), whereas clustering of three CWR PIs and all VWR populations was not as strong (58%). The two commercial source populations of CWR formed distinct nodes within the CWR cluster, indicating the genetic distinctness of materials originating from Oklahoma and Texas. Overlap between some of the CWR and VWR populations is perhaps not surprising. Vogel et al. (2006) reported comparable means and ranges for agronomic traits among Midwest populations classified as VWR and CWR. Morphological data, from populations in southern Oklahoma (Nelson and Tyrl, 1978), coupled with additional cytological and allozyme data from Texas populations (Davies, 1977) indicate that gene flow and introgression occurs in the wild between CWR and VWR populations.


Figure 1
View larger version (12K):
[in this window]
[in a new window]

 
Figure 1. An unrooted plot of consensus trees with a frequency greater than 50% after bootstrap analysis with 1000 replications. Bootstrap values are indicated on the trees. Genotypes represent 46 Canada wildrye (CW), 25 Virginia wildrye (VW), and four barley genotypes. PAUP* 4.0 beta was used to run the Neighbor joining algorithm. Genotypes correspond to the following populations: SH 143–150 = Sharp's; ST 154–159 = Stock's; CW 1–7 = 98CWR8; CW 11–18 = 99CWR6; CW 21–29 = 99CWR7; CW 31–38 = PI 436918; CW 41–49 = PI 436933; CW 51–56 = PI 613134; CW 62–70 = PI 436924; VW 71–78 = 03VWR2; VW 83–90 = PI 436945; VW 93–100 = PI 436955; VW 102–106 = PI 436962; VW 113–118 = PI 436968; S 122–123 = ‘Steptoe’ barley; M 132–133 = ‘Morex’ barley. E+ indicates populations that were endophyte infected based on polymerase chain reaction analysis.

 
Genotypes within a population generally clustered in or near one node. Essentially identical genotypes were found within PI 436933 (plants CW 47 and 49) and PI 436955 (plants VW94 and 99). Such a high degree of similarity within populations of self-pollinated Triticeae grasses in the wild is not uncommon (Nevo et al., 1982; Hegde et al., 2000). Our results contrast with that of Knapp and Rice (1996), who found substantial variation, based on isozyme analysis, within wild populations from the western United States of blue wildrye (Elymus glaucus Buckley), a self-pollinating, perennial tetraploid with the same genome constitution as CWR and VWR. A higher percentage of similarity existed within CWR compared to VWR populations (Fig. 1). These results indicate that in nature, cross-pollination has occurred more frequently in VWR than in CWR populations. However, given that variation within CWR and most VWR populations was similar to that within the barley cultivars, wildrye populations could be handled as pure lines in a breeding program. This is in contrast to self-pollinated crops where old cultivars and landraces have been found to commonly contain numerous genotypes (Russell et al., 2003; Zhang et al., 2006). One could speculate that farmer practices, such as seed trading, selection, and intentional seed mixing (Teshome et al., 2001), have resulted in landraces of self-pollinated crops consisting of diverse genotypes within a cultivated field, whereas in the wild, natural selection at a given site has led to wildrye populations consisting of nearly identical genotypes.

Sequence Variation
At higher taxonomic levels, SSR alleles identical by size are not necessarily identical by descent (Doyle et al., 1998). A microsatellite fragment, obtained from the primer pairs NFFA113, which was monomorphic based on length across the wildrye and barley genotypes, was randomly selected for sequencing to determine if there was sequence variation within wildrye. There were only three CGG repeats present in sequences of all wildrye populations and barley cultivars (Fig. 2 ), in contrast to six repeats in the tall fescue sequence (data not shown) from which the primer was developed. Over the 190 bp of sequence at this fragment, six single nucleotide substitutions were specific to barley, of which three were seen in the CWR wild population 99CWR6 (Fig. 2). Most of these polymorphisms occurred in flanking sequences close to the microsatellite region. Distinct sequence variation between CWR and VWR populations was not evident across the 190-bp sequence at this microsatellite locus. The genotype of 99CWR6 showed greater variation with six base substitutions, three of which were shared with barley (Fig. 2). The wildrye genotypes consist of SSHH genomes of which H genomes are also found in Hordeum species. Cytogenetic (Dewey, 1984), genomic DNA (Sun et al., 1997), and chloroplast DNA (McMillan and Sun, 2004) analysis support this classification, as does the sequence variation data presented here. Sequencing of SSR products of specific interest will be useful in identifying additional SNPs.


Figure 2
View larger version (81K):
[in this window]
[in a new window]

 
Figure 2. Sequences of fragments amplified by tall fescue expressed sequence tag–simple sequence repeat primer NFFA113 in barley cultivars and Canada wildrye and Virginia wildrye populations. Primer sequences are italicized, base substitutions are bold faced, and repeat sequences are in bold italics. The sequences represent a single genotype from each of the cultivars/populations.

 
Endophyte Analysis
Immunoblot analysis of tillers with a Neotyphodium-specific antibody was difficult to interpret as tillers from Elymus plants are often fine and the endophyte does not react well to the antibody. Therefore, epichloë endophyte infection was further characterized using a sensitive PCR-based screen to determine if any of the plant material was endophyte infected. Analysis of the seed stocks by PCR indicated that several CWR populations (98CWR8, 99CWR6, 99CWR7, PI 613164, Sharp's, Stock's) were infected with an Epichloë endophyte (Table 1; Fig. 3 ). This analysis was unable to determine if the endophyte was viable during germination and able to be transmitted to the seedling, but PCR of samples from young leaf blade showed that some of the plants used in this study were endophyte infected (Fig. 3). Analysis of the seeds from the VWR PIs indicated they were not infected or infected at a very low percentage. However, PCR analysis of leaf blade DNA samples from 03VWR2 indicated endophyte infection in at least two plants (Fig. 3); seed of this population was not available for PCR analysis. Sharp's, Stock's, and all of the recent collections of CWR from the wild had fungal endophytes, whereas PI 613134 was the only PI found to be endophyte infected.


Figure 3
View larger version (60K):
[in this window]
[in a new window]

 
Figure 3. Endophyte detection in seeds and leaf blades of Canada wildrye and Virginia wildrye populations. Twelve individual seeds from each population and DNA from leaf blades of each plant were screened for the presence of the tef1 gene from epichloë endophytes using endophyte-specific polymerase chain reaction primers.

 
To determine the phylogenetic origins of the epichloë endophyte, the amplified tef1 gene was sequenced from a selection of endophyte-positive seeds and compared to known Epichloë species. At least three different epichloë endophytes were found within these seed stocks based on the resulting sequence data (Table 1). Epichloë elymi, found in PI 613134, is commonly seen in CWR (White and Bultman, 1987) and was not unexpected. Recently, a VWR plant was found infected with an asexual E. amarillans (EViTG-1) (Moon et al., 2004). Extensive sequencing of the tef1 gene amplified from the Sharp's seed and the endophyte isolated from 99CWR7 indicated the presence of an E. amarillans–like sequence, but we did not determine if the endophyte was asexual. The epichloë endophyte contained in 98CWR8 was previously characterized as a hybrid of E. amarillans and E. elymi (Burr et al., 2007) similar to an isolate found in Hordeum bogdanii HboTG-1 (Moon et al., 2004). 99CWR6 also appeared to contain a hybrid of E. amarillans and E. elymi. The endophyte isolated from 03VWR2 was characterized as E. elymi, but it is unknown if the isolate is stromata producing. The sequence analysis of the tef1 gene amplified from the Stock's was inconclusive but is known to be an epichloë endophyte due to the specificity with the tef1 primers. Unfortunately, we were unable to culture the endophytes from the seed stock, which may indicate the endophytes were no longer viable.

Marker analysis of the CWR and VWR populations indicated that all endophyte-infected material, except 03VWR2, clustered together (Fig. 1), thus raising the question of whether some SSR markers may have been amplified from endophyte DNA, thus impacting subsequent cluster analysis. This would be highly unlikely due to the very low endophyte biomass within the leaf blade tissue that was sampled (Young et al., 2005; Panaccione et al., 2001). DNA was isolated from pure endophyte strains and amplified with TF EST-SSRs. Only eight of the primer pairs amplified products with endophyte DNA, and these are likely to be nonspecific products. The endophyte DNA fragments were quite different from the plant bands and were not visible when PCR was used to analyze DNA extracted from endophyte-infected plants. Thus, the dendrogram obtained from the fragment analysis was due to genetic variation in the microsatellite loci of the wildrye populations and was not influenced by the endophyte DNA in the sample.

We have established that a diversity of epichloë endophytes was associated with the wildrye populations we screened, but we have yet to determine the impact these endophytes will have on their host grasses. The alkaloid potential of these endophytes would require examination to determine if antimammalian compounds such as ergot alkaloids and lolitrems were produced in these endophyte-infected plants. Material infected with a sexual isolate has the potential to cause loss of seed production due to development of stromata that restrict (i.e., choke) emerging inflorescences. However, the presence of hybrid endophytes, and therefore presumably asexual Neotyphodium species, in at least some CWR germplasm suggests that these isolates would not hinder seed production. Further analysis will be required to determine if these endophytes will provide their host other agronomic qualities, such as drought tolerance and field persistence, as has been documented with Neotyphodium coenophialum–infected tall fescue (Bouton et al., 1993; Malinowski et al., 1997; West et al., 1993).


    CONCLUSIONS
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Several TF EST-SSRs proved useful in assessing genetic variation in CWR and VWR, thus identifying a functional set of microsatellite markers for these wildrye species. Using these SSRs, minimal genetic variation was detected within CWR and, to a lesser degree, VWR populations from the Southern Great Plains, indicating that germplasm collected directly from the wild, PIs, and commercial source populations of these species commonly consist of near pure lines. Pedigree, single-seed descent, bulk, and other breeding methods used for self-pollinated species would be appropriate for developing improved lines and cultivars of CWR and VWR. Breeders will need to be cognizant of the possible presence of potentially asexual and sexual endophytes in CWR and VWR breeding germplasm. Further research will be needed to determine the impact of endophyte infection in CWR and VWR on plant stress tolerance and grazing animal health.


    ACKNOWLEDGMENTS
 
The authors are very thankful to Jennifer Black, Konstantin Chekhovskiy, and Shipra Mittal for their technical assistance in this research. We are grateful to Drs. Mark Sorrells, Kelly Craven, and Maria Monteros for critically reviewing this manuscript.


    NOTES
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 
All rights reserved. No part of this periodical may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Permission for printing and for reprinting the material contained herein has been obtained by the publisher.

Received for publication May 8, 2008.


    REFERENCES
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 





This Article
Free via Open Access
Right arrow OA Abstract
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Supplemental Data
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Saha, M. C.
Right arrow Articles by Hopkins, A. A.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Saha, M. C.
Right arrow Articles by Hopkins, A. A.
Agricola
Right arrow Articles by Saha, M. C.
Right arrow Articles by Hopkins, A. A.
Related Collections
Right arrow Other Forage Crops
Right arrow Plant Genetic Resources
Right arrow Crop Genetics


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
The SCI Journals Agronomy Journal Vadose Zone Journal
Journal of Natural Resources
and Life Sciences Education
Soil Science Society of America Journal
Journal of Plant Registrations Journal of
Environmental Quality
The Plant Genome