Crop Science Illumina
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published online 16 January 2008
Published in Crop Sci 48:262-268 (2008)
© 2008 Crop Science Society of America
677 S. Segoe Rd., Madison, WI 53711 USA
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shi, A.
Right arrow Articles by Zhang, B.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Shi, A.
Right arrow Articles by Zhang, B.
Agricola
Right arrow Articles by Shi, A.
Right arrow Articles by Zhang, B.
Related Collections
Right arrow Soybean
Right arrow Cell Biology & Molecular Genetics
Right arrow Crop Genetics

A PCR-based Marker for the Rsv1 Locus Conferring Resistance to Soybean Mosaic Virus

Ainong Shi, Pengyin Chen*, Cuiming Zheng, Anfu Hou and Bo Zhang

Dep. of Crop, Soil, and Environmental Sciences, Univ. of Arkansas, Fayetteville, AR 72701

* Corresponding author (pchen{at}uark.edu).


    ABSTRACT
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Soybean mosaic virus (SMV) is a highly destructive viral disease. Three loci with 12 alleles conferring SMV resistance have been identified in soybean [Glycine max (L.) Merr.]. The objective of this study was to develop polymerase chain reaction–based markers for detecting the candidate gene 3gG2 at the Rsv1 locus for SMV resistance in diverse soybean germplasm. A pair of DNA primers, Rsv1-f/r, was developed from the 3gG2 sequence. This primer pair produced a 341-bp DNA fragment specific for soybean cultivars containing Rsv1. The same fragment was confirmed in genotypes containing Rsv1 alleles including ‘Kwanggyo’ (Rsv1-k), ‘Marshall’ (Rsv1-m), ‘Ogden’ (Rsv1-t), PI 96983 (Rsv1), PI 507389 (Rsv1-n), ‘Raiden’ (Rsv1-r), and ‘Suweon 97’ (Rsv1-s). The Rsv1-f/r fragment was also amplified in genotypes with two-gene combinations (Rsv1Rsv3 and Rsv1Rsv4) but not in genotypes containing only Rsv3 or Rsv4 or in the susceptible genotypes. The primer pair was used to screen for Rsv1 alleles in 97 SMV resistant genotypes. Results showed that 55 genotypes contained the 3gG2 gene, while 17 genotypes carrying the Rsv1-y allele and additional 25 SMV-resistant genotypes carrying Rsv3 or Rsv4 were not amplified a product using the 3gG2 primer pair. Analysis of an F2 population derived from J05 (Rsv1Rsv3) x ‘Essex’ (rsv1rsv3) showed a cosegregation between the marker Rsv1-f/r and the Rsv1 allele. Rsv1-f/r was also shown to be linked to simple sequence repeat marker Satt114 on soybean molecular linkage group F with a distance of 5.42 cM. This marker will give breeders a tool for marker-assisted selection and gene pyramiding in soybean breeding for SMV resistance.

Abbreviations: MAS, marker-assisted selection • MLG, molecular linkage group • PCR, polymerase chain reaction • PI, plant introduction • RAPD, random amplification of polymorphic DNA • RFLP, restriction fragment length polymorphism • SMV, Soybean mosaic virus • SSR, simple sequence repeat.



    NOTES
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
All rights reserved. No part of this periodical may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Permission for printing and for reprinting the material contained herein has been obtained by the publisher.

Received for publication February 10, 2007.

A PCR-based Marker for the Rsv1 Locus Conferring Resistance to Soybean Mosaic Virus

Ainong Shi, Pengyin Chen*, Cuiming Zheng, Anfu Hou and Bo Zhang

Dep. of Crop, Soil, and Environmental Sciences, Univ. of Arkansas, Fayetteville, AR 72701

* Corresponding author (pchen{at}uark.edu).

Soybean mosaic virus (SMV) is a highly destructive viral disease. Three loci with 12 alleles conferring SMV resistance have been identified in soybean [Glycine max (L.) Merr.]. The objective of this study was to develop polymerase chain reaction–based markers for detecting the candidate gene 3gG2 at the Rsv1 locus for SMV resistance in diverse soybean germplasm. A pair of DNA primers, Rsv1-f/r, was developed from the 3gG2 sequence. This primer pair produced a 341-bp DNA fragment specific for soybean cultivars containing Rsv1. The same fragment was confirmed in genotypes containing Rsv1 alleles including ‘Kwanggyo’ (Rsv1-k), ‘Marshall’ (Rsv1-m), ‘Ogden’ (Rsv1-t), PI 96983 (Rsv1), PI 507389 (Rsv1-n), ‘Raiden’ (Rsv1-r), and ‘Suweon 97’ (Rsv1-s). The Rsv1-f/r fragment was also amplified in genotypes with two-gene combinations (Rsv1Rsv3 and Rsv1Rsv4) but not in genotypes containing only Rsv3 or Rsv4 or in the susceptible genotypes. The primer pair was used to screen for Rsv1 alleles in 97 SMV resistant genotypes. Results showed that 55 genotypes contained the 3gG2 gene, while 17 genotypes carrying the Rsv1-y allele and additional 25 SMV-resistant genotypes carrying Rsv3 or Rsv4 were not amplified a product using the 3gG2 primer pair. Analysis of an F2 population derived from J05 (Rsv1Rsv3) x ‘Essex’ (rsv1rsv3) showed a cosegregation between the marker Rsv1-f/r and the Rsv1 allele. Rsv1-f/r was also shown to be linked to simple sequence repeat marker Satt114 on soybean molecular linkage group F with a distance of 5.42 cM. This marker will give breeders a tool for marker-assisted selection and gene pyramiding in soybean breeding for SMV resistance.

Abbreviations: MAS, marker-assisted selection • MLG, molecular linkage group • PCR, polymerase chain reaction • PI, plant introduction • RAPD, random amplification of polymorphic DNA • RFLP, restriction fragment length polymorphism • SMV, Soybean mosaic virus • SSR, simple sequence repeat.


    INTRODUCTION
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
SOYBEAN MOSAIC VIRUS (SMV) is one of the most destructive viral diseases in soybean [Glycine max (L.) Merr.]. The use of genetic resistance is the most effective method of controlling this disease. Genetic resistance to SMV has been identified in various soybean cultivars, breeding lines, and plant introductions (PIs) (Cho and Goodman, 1982; Lim, 1985; Wang et al., 1998, 2005; Zheng et al., 2005). However, only a few soybean genotypes have been investigated for specific SMV resistance genes using inheritance study and allelism tests. Three independent loci, Rsv1, Rsv3, and Rsv4, conferring SMV resistance have been identified and mapped on different molecular linkage groups (MLG) of soybean (Hayes et al., 2000; Jeong et al., 2002; Yu et al., 1994). Nine alleles have been reported at the Rsv1 locus: Rsv1 (PI 96983), Rsv1-h (Suweon 97), Rsv1-k (Kwanggyo), Rsv1-m (Marshall), Rsv1-n (PI 507389), Rsv1-r (Raiden), Rsv1-s (LR1), Rsv1-t (Ogden), and Rsv1-y (York) (Chen and Choi, 2007). Rsv1 was mapped on the soybean MLG F (Yu et al., 1994); Rsv3 on MLG B2 (Jeong et al., 2002); and Rsv4 on MLG D1b (Hayes et al., 2000).

Rsv1 was first identified as a single allele (Kiihl and Hartwig, 1979) and later mapped on the MLG F; and two restriction fragment length polymorphism (RFLP) markers, pA 186 and pK 644a, and one simple sequence repeat (SSR) marker, SM176, were found to be tightly linked to Rsv1 with distances of 1.5, 2.1, and 0.5 cM, respectively (Yu et al., 1994). A high-resolution map of the Rsv1 region was later constructed with 38 loci, including one random amplification of polymorphic DNA (RAPD), four SSRs, and 19 RFLPs (Gore et al., 2002). A RAPD marker OPN11980/1070 and its derived sequence characterized amplified region (SCAR) marker SCN11980/1070 were also identified as linked to Rsv1 with a distance of 3.03 cM (Zheng et al., 2003). Rsv1 is recognized as not only a complex locus with multiple alleles, but also a diverse locus region with a multigene cluster. For example, Rpv1 for resistance to Peanut mottle virus is tightly linked to Rsv1 at a distance of 1.1 cM (Gore et al., 2002). So far, nine alleles at the Rsv1 locus have been identified in nine differential genotypes on the basis of their reaction patterns to seven SMV strains in the United States (Chen and Choi, 2007). However, some soybean genotypes were found to contain more than one allele at the Rsv1 locus for SMV resistance (Gore et al., 2002). For instance, PI 96983 was first identified to carry one dominant gene Rsv1 (Kiihl and Hartwig, 1979). Later, 12 nucleotide binding site resistance gene analogs were mapped at the Rsv1 locus in PI 96983 (Jeong et al., 2001). Several tightly linked genes controlling SMV resistance in the Rsv1 region were also verified in PI 96983 in an independent study (Gore et al., 2002).

Recently, Hayes et al. (2004) reported six clones on MLG F around the Rsv1 locus associated with SMV resistance and three of them were completely sequenced (GenBank accession no. AY518517AY518519) (http://www.ncbi.nlm.nih.gov/Genbank/index.html). One of the six clones, 3gG2 gene, cosegregated with Rsv1 and the distance between 3gG2 and Rsv1 was 0 cM in a population derived from PI 96983. Marshall carrying Rsv1-m and Ogden carrying Rsv1-t (Chen et al., 2001) were also reported to contain the 3gG2 gene (Hayes et al., 2004). Soybean genotypes carrying other alleles at the Rsv1 locus have not been tested for 3gG2. Soybean genotypes with Rsv4 or two or three gene combinations such as Rsv1+3, Rsv1+4, Rsv3+4, Rsv1+3+4 cannot be distinguished by host reactions to SMV strains G1 through G7 because they are resistant to all seven strains. However, gene-specific molecular markers, if available, can be used to identify specific alleles for SMV resistance in soybean. Although Hayes et al. (2004) developed two pairs of nested primers, 3gG2-5'A/3gG2-3'A and 3gG2-5'B/3gG2-3'B specific for detection of the gene 3gG2 in soybean, it was not feasible to use them in gene discovery because the DNA fragments amplified from the two primer pairs are greater than 3 kb, which is difficult to be amplified. The nested primer pairs failed to detect the 3gG2 gene in our tests because no band or more than one band was visualized in our tested soybean genotypes regardless of presence or absence of Rsv1. The objective of this research was to develop a polymerase chain reaction (PCR)-based marker for detection of 3gG2 at the Rsv1 locus in diverse soybean germplasm and to provide breeders with a tool for marker-assisted selection (MAS) and gene pyramiding in breeding soybeans for SMV resistance.


    MATERIALS AND METHODS
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
Plant Materials and Virus Test
One hundred and one soybean genotypes including 97 SMV resistant and four susceptible genotypes were selected for this research. The reactions to SMV strains G1 to G7 (Cho and Goodman, 1979) were evaluated in the greenhouse. Most of the soybean genotypes in this research were previously screened with SMV strains G1 and G7 and resistance genes have been proposed (Zheng et al., 2005) (Table 1 ), whereas some of them were later tested with five or seven SMV strains in another experiment (Zheng et al., 2006b). One hundred thirty-eight F2 plants derived from J05 x Essex were also evaluated for their SMV reactions to G1 and G7 in the greenhouse. Essex is susceptible to all seven SMV strains. J05, a Chinese soybean cultivar, was reported to have two SMV resistance genes, Rsv1 and Rsv3 (Zheng et al., 2006a). The Rsv1 gene provides resistance to G1 but conditions a susceptible or necrotic reaction to G7. Rsv3 confers resistance to G7 but a susceptible reaction to G1. All 138 F2 plants were inoculated with G1 to detect genetic segregation of the Rsv1 locus. Each plant was classified as resistant (R, symptomless), necrotic (N, stem-tip necrosis), or susceptible (S, mosaic or chlorosis). The SMV strains were provided by Dr. S. Tolin of Virginia Polytechnic Institute and State University (Blacksburg, VA). The methods of mechanical inoculation and testing for virus infection were previously described by Zheng et al. (2005, 2006a).


View this table:
[in this window]
[in a new window]

 
Table 1. Reaction to Soybean mosaic virus (SMV) and presence of polymerase chain reaction (PCR)–based marker Rsv1-f/r, which detects the candidate gene 3gG2 at the Rsv1 locus for SMV resistance, in 101 soybean genotypes.

 
DNA Extraction and PCR-Based Assay
Genomic DNA was extracted from fresh soybean leaves of greenhouse-grown plants using the CTAB (hexadecyltrimethyl ammonium bromide) method (Kisha et al., 1997). One specific primer pair Rsv1-f (TCCTACAAATTCTTTCACGCTC)/Rsv1-r (GGCACTATAAATTGTTTAACTA) was designed from the sequence of the candidate gene 3gG2 at Rsv1 locus for SMV resistance (GenBank accession: AY518517) using the Software Primer 3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) and checked for its specificity to the gene 3gG2 using Blast and information in GenBank. The primer pair was first screened in seven genotypes carrying different alleles at Rsv1 locus including Kwanggyo (Rsv1-k), Marshall (Rsv1-m), Ogden (Rsv1-t), PI 96983 (Rsv1), Raiden (Rsv1-r), Suweon 97 (Rsv1-h), and York (Rsv1-y) and one susceptible cultivar Essex (rsv). The Rsv1-specific marker Rsv1-f/r and the SSR marker Satt114 on MLG F (Cregan, 2003) were run in the F2 population derived from J05 x Essex to examine cosegregation or linkage between the marker and Rsv1. Eight additional SSR markers, Sat_297, Sat_229, Sat_234, SOYHSP176, Sat_154, Satt510, Sat_317, and Sct_033 located in the Rsv1 region on soybean MLG F (Cregan, 2003), were also used to construct genetic map for the 3gG2 gene region.

Polymerase chain reaction amplification was performed in an iCycler Thermal Cycler (Bio-Rad Laboratories, Inc., Hercules, CA) following standard PCR procedures with minor modifications. Briefly, each 50 µL PCR mixture consisted of 36 µL sterilized ddH2O, 5 µL 10x PCR buffer, 3 µL MgCl2 (25 mM), 1.5 µL dNTP (10 mM total, 2.5 mM each), 1.5 µL each primer (20 ng µL–1), 0.2 µL Taq polymerase (Promega, Madison, WI) (5 U µL–1), and 1.3 µL template DNA (20 ng µL–1). Polymerase chain reaction cycles consisted of an initial denaturation step at 94°C for 5 min followed by 38 cycles of 45 s at 94°C (denaturation), 45 s at 45 to 55°C (annealing) depending on the primer Tm (52°C for Rsv1-f/r), and 1 min at 72°C (extension). An extension cycle at 72°C for 5 min was followed by a 4°C soak. The PCR products were separated on 6% nondenaturing polyacrylamide gel or 1.0 to 1.5% agarose gel in 0.5x TBE, and visualized by staining with ethidium bromide.

Linkage Analysis
Segregation ratios for SMV reaction and the molecular data of the F2 population derived from J05 x Essex were tested for goodness-of-fit and independence using a chi-square test (Liu, 1998). Linkage analysis was performed based on the maximum likelihood estimator (Allard, 1956). The recombination fraction (r) was calculated using a SAS program (SAS Institute, Cary, NC), which was kindly provided by Dr. Ben-Hui Liu, Department of Forestry at North Carolina State University (Raleigh, NC) (Liu, unpublished data, 1996). The recombination fraction between loci was transformed according to the Kosambi function using the formula CAB = 1/4ln [(1 + 2r)/(1 – 2r)] x 100 (Weir, 1996), where CAB is the map distance (cM), and r is the estimated recombination fraction.


    RESULTS AND DISCUSSION
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 
The primer pair Rsv1-f/r consistently produced a 341-bp DNA fragment (referred to as Rsv1-f/r fragment hereafter), which is specific for soybean genotypes containing the 3gG2 gene at the Rsv1 locus. This fragment was amplified in Kwanggyo (Rsv1-k), Marshall (Rsv1-m), Ogden (Rsv1-t), PI 96983 (Rsv1), Raiden (Rsv1-r), and Suweon 97 (Rsv1-h), but not in York (Rsv1-y) or the susceptible cultivar Essex (rsv) in an initial screen (Fig. 1 ). In another screen the same fragment was confirmed in genotypes with Rsv1 alleles including Kwanggyo (Rsv1-k), Marshall (Rsv1-m), Ogden (Rsv1-t), PI 507389 (Rsv1-n), PI 96983 (Rsv1), Raiden (Rsv1-r), and Suweon 97 (Rsv1-s) and genotypes with two-gene combinations including Hourei (Rsv1Rsv3), Tousan 140 (Rsv1Rsv3), Zao 18 (Rsv1Rsv3), OX 670 (Rsv1Rsv3), Tousan 140 (Rsv1Rsv3), J05 (Rsv1Rsv3), and PI 486355 (Rsv1Rsv4). The Rsv1-f/r fragment was not amplified in genotypes that contained Rsv3 alone (Hardee, Harosoy, L29, and OX 686), Rsv4 alone (PI 88788, Peking, and V94–5152), both Rsv3 and Rsv4 (Columbia), or in the susceptible genotypes such as Essex and Lee 68 (rsv) (Table 1).


Figure 1
View larger version (57K):
[in this window]
[in a new window]

 
Figure 1. DNA fragments amplified from the primer pair Rsv1-f/r (Lanes 1–8) on 1.3% agarose gel. 1, Essex (rsv); 2, PI 96983 (Rsv1); 3, Marshall (Rsv1-m); 4, York (Rsv1-y); 5, Raiden (Rsv1-r); 6, Kwanggyo (Rsv1-k); 7, Ogden (Rsv1-t); and 8, Suweon 97 (Rsv1-h). Lane M is a 100-bp molecular-weight marker.

 
The primer pair Rsv1-f/r was used to screen a total of 97 SMV resistant and four susceptible soybean genotypes (Table 1). The four susceptible genotypes (Essex, FG4, Lee 68, and S02-8136) did not amplify the Rsv1-f/r fragment. Fifty-one genotypes, which carry Rsv1, Rsv1-k, Rsv1-m, Rsv1-t, Rsv1-n, Rsv1-h, Rsv1-r, or two genes (Rsv1Rsv3 or Rsv1Rsv4), produced the Rsv1-f/r fragment (Table 1), indicating the presence of 3gG2 in these genotypes. Among the 51 genotypes, all 29 resistant genotypes except PI 181550, which showed resistance to G1 and necrosis to G7, were identified as containing Rsv1, Rsv1-k, Rsv1-m, or Rsv1-t; three genotypes, necrotic to G1 and susceptible or resistant to G7, contain Rsv1-n; and 19 genotypes, resistant to both strains, carry Rsv-r, Rsv1-s, Rsv-h, Rsv1Rsv3, or Rsv1Rsv4. PI 181550 did not produce the DNA fragment amplified by Rsv1-f/r, although it exhibited the same reactions to G1 and G7 as PI 96983 and Kwanggyo (Zheng et al., 2005), indicating PI 181550 does not carry 3gG2 or there is a mutation in the allele.

Among the Rsv1-f/r positive genotypes, Holladay, Hood, L93-3327, Mercury, Saturn, and Tousan 122 had the same SMV reaction pattern as Ogden (Rsv1-t) (Chen et al., 2001) and thus were postulated to carry Rsv1-t (Zheng et al., 2006b). Ani 31, Iwate No. 1, Iwate wase kurome, Nohrin No. 3, PI 181555, PI 181557, Sakyuu Ki Mame, Shakkin-nashi, Shimoda Shitachi, Shin No. 4, Tokishi, Tousan 26, and Tousan 58 showed the same pattern as Kwanggyo (Rsv1-k) (Chen et al., 2001) for SMV reaction and were postulated to possess Rsv1-k (Zheng et al., 2006b). Marshall has the single gene Rsv1-m for SMV resistance (Chen et al., 2001). Three genotypes (PI 507389, V262, and PI 61944) exhibited necrotic reaction to G1. PI 507389 and its derived line V262 [Essex (5) x PI 507389] contained the single gene Rsv1-n (Ma et al., 2003). Suweon 97 and its derived line L92-8580 [Williams (6) x Suweon97] carry the Rsv1-h gene (Chen et al., 2002) whereas Raiden and its derived line L88-8431 [Williams (6) x Raiden] contain the Rsv1-r gene for SMV resistance (Chen et al., 2001). Enrei, Miyagi Shirome, Tanrei, and Tsuronoko were postulated to have the Rsv1-r or Rsv1-s gene (Zheng et al., 2006b). PI 61944 and PI 61947 were postulated to have a new allele at the Rsv1 locus because their SMV reaction patterns were different from all those with known alleles at the Rsv1 locus (Zheng et al., 2006b). The Chinese cultivar, Jiunong 21 and three Japanese genotypes, Azeminori, Houjaku Kuwazu, PI 339868B (Yuwoltae), were postulated to have the Rsv1-h gene or two-gene combinations (Rsv1Rsv3, Rsv1Rsv4). Hourei, OX670, and Tousan 140 (Gunduz et al., 2001, 2002), Zao 18 (Liao et al., 2002), and J05 (Zheng et al., 2006a) were reported to contain both Rsv1 and Rsv3. PI 486355 contains both Rsv1 and Rsv4 (Chen et al., 1993). These results demonstrated that the marker Rsv1-f/r was a very effective tool for identifying the 3gG2 gene in soybean germplasm. The marker screening data also confirmed the presence of the 3gG2 gene in SMV resistant soybean genotypes carrying Rsv1, Rsv1-k, Rsv1-m, Rsv1-t, Rsv1-n, Rsv1-h, Rsv1-r, or two-gene combinations with Rsv1 (Rsv1Rsv3, Rsv1Rsv4).

Among the 21 genotypes (including 15 from the United States, four from Korea, one from China, and one from Japan) that were resistant to G1 but susceptible to G7 (Table 1), only four genotypes (Clifford, Corsica, Nooki No. 1, and PI 398877) showed the DNA fragment amplified from the primer pair Rsv1-f/r, indicating that these four genotypes with the Rsv1-f/r fragment contain the 3gG2 gene and the other 17 genotypes may not. York was identified to have the single gene Rsv1-y conferring resistance to G1 but susceptibility to G7 (Chen et al., 1991, 1994) and the Rsv1-y gene in York was postulated to be derived from its ancestor Arksoy (Zheng et al., 2005). All 11 Arksoy-derived SMV resistant genotypes including Brim, Calhoun, Cook, Davis, Dillon, Doles, Musen, Prolina, Ripley, York, and Young exhibited the same SMV reaction pattern as York and none produced the Rsv1-f/r fragment, indicating the absence of 3gG2 in these genotypes. Several other soybean genotypes in Table 1 with the same SMV reaction pattern as York also did not produce the Rsv1-f/r fragment but they were postulated to have the Rsv1-y gene (Zheng et al., 2005). These results indicate that Rsv1-y may be a different gene from 3gG2. In contrast, four genotypes, Clifford, PI 398877, Corsica, and Nooki No. 1, amplified the Rsv1-f/r fragment and showed the same SMV reaction as York (resistance to G1 but susceptible to G7). However, additional SMV strain tests indicated that the reactions to five SMV strains (G1, G3, G5, G6, and G7) in Clifford and Corsica were different to those in York. York was resistant to G1 and G3, and susceptible to G5, G6, and G7, whereas Clifford was resistant to G1 and G6, necrotic to G3 and G5, and susceptible to G7; Corsica was resistant to G1 but susceptible to all the other strains. These results suggest that Clifford and Corsica may contain different alleles from Rsv1-y of York. The reason that Nooki No. 1 and PI 398877 produced the DNA fragment amplified from Rsv1-f/r although they had the same SMV reaction pattern as York is not known and deserves further research. These results show the complexity of the Rsv1 locus.

Twenty-five SMV resistant genotypes did not produce the Rsv1-f/r fragment, indicating that these genotypes do not contain the 3gG2 gene (Table 1). Among the 25 genotypes, 10 were resistant to G7 but susceptible to G1 and postulated to carry Rsv3 (Zheng et al., 2005); and the other 15 were resistant to both strains and presumably carry the Rsv4 gene or two-gene combination Rsv3 Rsv4. For example, V94-5152 (Buss et al., 1997; Ma et al., 1995), PI 88788 (Gunduz et al., 2004), and Peking (Palmer et al., 2004), each carried an Rsv4 gene whereas Columbia contained Rsv3 and Rsv4 (Ma et al., 2002). These results confirmed that the marker Rsv1-f/r can be used to distinguish Rsv1 from Rsv3 or Rsv4.

The primer pair Rsv1-f/r was used to verify the segregation of 3gG2 in 138 F2 plants derived from J05 (Rsv1Rsv3) x Essex (rsv1rsv3). The results showed, as expected, that resistant plants had the Rsv1-f/r fragment, but susceptible plants did not (Fig. 2 ). The F2 segregation for SMV resistance (Rsv1) phenotype and for the maker Rsv1-f/r fit a 3:1 ratio as expected for a single dominant gene and for a dominant marker (Table 2 ). The SMV resistance to G1 in J05 was shown to be controlled by the dominant gene Rsv1 (Zheng et al., 2006a). The marker Rsv1-f/r also showed a dominant allele for this locus. Therefore, there are four possible phenotype combinations between SMV resistance and the marker Rsv1-f/r in the F2 population: R+ (SMV resistant and presence of the Rsv1-f/r fragment; R– (SMV resistant and absence of the Rsv1-f/r fragment); S+ (SMV susceptible and presence of the Rsv1-f/r fragment; and S– (SMV susceptible and absence of the Rsv1-f/r fragment). The marker Rsv1-f/r was calculated to have a distance of 0.7 cM to the resistance allele (Rsv1) in our mapping population (Table 2). Hayes et al. (2004) reported that the distance between 3gG2 and Rsv1 was 0.0 cM. Because the gene-specific primer pair Rsv1-f/r was designed from the sequence of 3gG2, the marker should theoretically cosegregate with Rsv1 with a 0 cM distance. Therefore, the plant (one out of 138) with the S+ phenotype may have resulted from an experimental error. However, the possibility that this S+ plant may represent a true recombination cannot be ruled out. Since no seed was harvested from this susceptible F2 plant, we were not able to confirm the F2 genotype using the F2:3 phenotypic data of SMV reaction. Nevertheless, these results confirmed that J05 contains the gene 3gG2 at the Rsv1 locus and also showed that marker Rsv1-f/r could be used to identify this gene very effectively.


Figure 2
View larger version (25K):
[in this window]
[in a new window]

 
Figure 2. Amplification patterns of the marker with the primer pair Rsv1-f/r in 33 plants of the F2 population derived from J05 x Essex on 1.3% agarose gel. R, resistant plant; S, susceptible plant.

 

View this table:
[in this window]
[in a new window]

 
Table 2. Cosegregation of the marker Rsv1-f/r for 3gG2 and the Rsv1 gene for Soybean mosaic virus (SMV) resistance in the F2 population derived from J05 x Essex.

 
One SSR marker Satt114 located at 63.689 cM on the MLG F (Cregan et al., 1999; Cregan, 2003) showed a clear polymorphism between the two parents and among the individual plants of the F2 population from J05 x Essex (Fig. 3 ). The linkage between Rsv1-f/r and Satt114 was analyzed and the distance between them was calculated using the F2 data (Table 3 ). The marker M1 (Rsv1-f/r) is a dominant marker; M1 signifies the presence of the Rsv1-f/r fragment and m1 the absence of the Rsv1-f/r for this marker; both phenotypes of M1M1 and M1m1 would show one band of the same size. The SSR marker M2 (Satt114) is a codominant marker and M2 and m2 present two separate bands of different size. Therefore, M2M2 shows a phenotype with one band, m2m2 with a different sized band, and M2m2 with both bands. The six possible phenotypes from the two markers M1 and M2 include M1_M2M2, M1_M2m2, M1_m2m2, m1m1M2M2, m1m1M2m2, and m1m1m2m2. M1_M2M2 indicates plants that produce one band amplified from Rsv1-f/r and one band from Satt114; M1_M2m2 indicates plants that produce one band amplified from Rsv1-f/r and two bands from Satt114; M1_m2m2 indicates plants that produce one band amplified from Rsv1-f/r and a different sized band from Satt114; m1m1M2M2 indicates plants that do not produce any band amplified from Rsv1-f/r but one band from Satt114; m1m1M2m2 indicates plants that do not produce any band amplified from Rsv1-f/r but two bands from Satt114; and m1m1m2m2 indicates plants that do not produce any band amplified from Rsv1-f/r but one band of different size from Satt114. The F2 segregation for Rsv1-f/r fit a 3:1 ratio as expected for a single dominant marker and a 1:2:1 ratio for Satt114 as expected for a codominant marker (Table 3). The two markers (Rsv1-f/r and Satt114) were found to be linked with a distance of 5.42 cM, indicating that the 3gG2 gene was located at around 69.11 cM of the MLG F. The Rsv1 locus was previously mapped on the soybean MLG F and was closely linked to the SSR marker Satt510 (<2.4 cM) (Gore et al., 2002). Based on the soybean SSR linkage map (Cregan, 2003), the Rsv1 is postulated to be located near Sat_154 at 68.91 cM of the MLG F. A genetic map for the 3gG2 gene region between Sat_297 at 59.60 cM and Sct_033 at 74.13 cM of the MLG F was constructed (Fig. 4 ). Thus, the marker Rsv1-f/r further confirmed the specific location for the 3gG2 gene at the Rsv1 locus.


Figure 3
View larger version (48K):
[in this window]
[in a new window]

 
Figure 3. Amplification patterns of the DNA fragments with the simple sequence repeat (SSR) primer Satt 114 in 34 plants of the F2 population derived from J05 x Essex and two parents on 6% nondenaturing polyacrylamide gel. P1, J05; P2, Essex; R, resistant F2 plant; S, susceptible F2 plant. Lane M is a 100-bp molecular-weight marker.

 

View this table:
[in this window]
[in a new window]

 
Table 3. Cosegregation of the marker Rsv1-f/r for 3gG2 and the SSR marker Satt 114 on soybean molecular linkage group (MLG) F in the F2 population derived from J05 x Essex.

 

Figure 4
View larger version (13K):
[in this window]
[in a new window]

 
Figure 4. A genetic map around the 3gG2 gene at the Rsv1 locus region between Sat_297 at 59.60 cM and Sct_033 at 74.13 cM of the molecular linkage group (MLG) F. The map was constructed using simple sequence repeat (SSR) marker Satt 114 and specific primer pair Rsv1-f/r for the 3gG2 gene in the J05 x Essex population combined with eight existing SSR makers as reference from the soybean molecular linkage map by Cregan (2003).

 
The marker Rsv1-f/r is the 3gG2 gene-specific marker which was confirmed in this study and can be used to identify the specific gene 3gG2 at the Rsv1 locus in soybean germplasm with SMV resistance effectively. As more genes are cloned and sequenced and more gene-specific markers are developed, it will be feasible for breeder to detect specific genes in soybean germplasm and put them into use for MAS in soybean breeding programs. This research provides breeders with an effective approach for using a gene-specific marker to select for SMV resistance in soybean.

All rights reserved. No part of this periodical may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Permission for printing and for reprinting the material contained herein has been obtained by the publisher.

Received for publication February 10, 2007.


    REFERENCES
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 REFERENCES
 




This article has been cited by other articles:


Home page
J HeredHome page
A. Shi, P. Chen, D. X. Li, C. Zheng, A. Hou, and B. Zhang
Genetic Confirmation of 2 Independent Genes for Resistance to Soybean Mosaic Virus in J05 Soybean Using SSR Markers
J. Hered., November 1, 2008; 99(6): 598 - 603.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Shi, A.
Right arrow Articles by Zhang, B.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Shi, A.
Right arrow Articles by Zhang, B.
Agricola
Right arrow Articles by Shi, A.
Right arrow Articles by Zhang, B.
Related Collections
Right arrow Soybean
Right arrow Cell Biology & Molecular Genetics
Right arrow Crop Genetics


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
The SCI Journals Agronomy Journal Vadose Zone Journal
Journal of Natural Resources
and Life Sciences Education
Soil Science Society of America Journal
Journal of Plant Registrations Journal of
Environmental Quality
The Plant Genome