HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Figures Only Full Text (PDF) Free Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Ballou, S. M. Articles by de los Reyes, B. G. Search for Related Content PubMed Articles by Ballou, S. M. Articles by de los Reyes, B. G. Agricola Articles by Ballou, S. M. Articles by de los Reyes, B. G. Related Collections Gene Expression Plant and Environment Interactions

GENOMICS, MOLECULAR GENETICS & BIOTECHNOLOGY-NOTES

Cold Sensitivity Gradient in Tuber-Bearing Solanum Based on Physiological and Transcript Profiles

^a Jacob Shur Research Facility, Maine Agricultural and Forest Experiment Station, Univ. of Maine, Orono, ME 04469
^b Dep. of Biological Sciences, Univ. of Maine, 5735 Hitchner Hall, Orono, ME 04469

^* Corresponding author (benildo.de{at}maine.edu).

	ABSTRACT

TOP NOTES ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
Tuber-bearing Solanum species exhibit a wide variation with respect to cold sensitivity. Physiological evaluation based on the leakage of cellular electrolytes showed a continuous gradient of sensitivity among cultivated and wild species, which ranged from chilling sensitivity to freezing tolerance by cold acclimation (CA). Solanum trifidum Correll, a chilling-sensitive species, defines the baseline of cold tolerance within the genus, while S. commersonii Dunal, a cold-acclimating species, represents the hardiest end of the spectrum. Solanum species at the extreme ends of the sensitivity gradient exhibited distinct expression signatures for selected CA-associated genes (CBF1, ZAT12, COR47, and GolS3). Transcription factor (CBF1 and ZAT12) expression was positively correlated with CA but not with the sensitivity gradient among nonacclimating species. Variation across the sensitivity gradient was reflected by the differences in induction profiles of nonregulatory genes (COR47 and GolS3).

Abbreviations: CA, cold acclimation • ELI, electrolyte leakage index • EST, expressed sequence tag • PCR, polymerase chain reaction • qPCR, quantitative real-time polymerase chain reaction • RT-PCR, semiquantitative real-time polymerase chain reaction

Cold Sensitivity Gradient in Tuber-Bearing Solanum Based on Physiological and Transcript Profiles

^a Jacob Shur Research Facility, Maine Agricultural and Forest Experiment Station, Univ. of Maine, Orono, ME 04469
^b Dep. of Biological Sciences, Univ. of Maine, 5735 Hitchner Hall, Orono, ME 04469

^* Corresponding author (benildo.de{at}maine.edu).

Tuber-bearing Solanum species exhibit a wide variation with respect to cold sensitivity. Physiological evaluation based on the leakage of cellular electrolytes showed a continuous gradient of sensitivity among cultivated and wild species, which ranged from chilling sensitivity to freezing tolerance by cold acclimation (CA). Solanum trifidum Correll, a chilling-sensitive species, defines the baseline of cold tolerance within the genus, while S. commersonii Dunal, a cold-acclimating species, represents the hardiest end of the spectrum. Solanum species at the extreme ends of the sensitivity gradient exhibited distinct expression signatures for selected CA-associated genes (CBF1, ZAT12, COR47, and GolS3). Transcription factor (CBF1 and ZAT12) expression was positively correlated with CA but not with the sensitivity gradient among nonacclimating species. Variation across the sensitivity gradient was reflected by the differences in induction profiles of nonregulatory genes (COR47 and GolS3).

Abbreviations: CA, cold acclimation • ELI, electrolyte leakage index • EST, expressed sequence tag • PCR, polymerase chain reaction • qPCR, quantitative real-time polymerase chain reaction • RT-PCR, semiquantitative real-time polymerase chain reaction

	INTRODUCTION

TOP NOTES ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
PLANTS EXHIBIT different degrees of sensitivity to low temperature, depending on their geographic origin and distribution. Differences can be defined with respect to sensitivity to above-freezing or freezing temperatures. Plants of tropical origin are generally more sensitive to chilling (10°C and above). In contrast, plants of temperate origin are insensitive to chilling and many are able to increase their level of tolerance to freezing with cold acclimation (CA) or hardening (Pearce, 1999).

Cultivated species of solanaceous plants have a narrow range of cold tolerance. Potato (Solanum tuberosum L.) is generally more tolerant to chilling than its closely related cousin tomato (Solanum lycopersicon L., syn. Lycopersicon esculentum Mill. var. esculentum), which is easily injured even by exposure to temperatures >10°C (Venema et al., 2005). Furthermore, a wider range of variation exists within the tuber-bearing Solanum species, which include >200 exotic species in addition to the cultivated potato (Hawkes, 1990). For example, a number of studies during the last few decades have shown that some of the wild relatives of potato are not only tolerant to chilling but are also able to withstand frost with limited injury when acclimated by prior exposure to above-freezing temperatures. At the lower end of the spectrum are some wild Solanum species that can be severely injured even by mild chilling (Vega et al., 2004; Carputo et al., 2003; Chen and Li, 1980; Li, 1977; Sukumaran and Weiser, 1972).

Responses to chilling and freezing temperatures involve largely similar and integrated physiological processes defined by hundreds of genes with diverse molecular or biochemical functions (Gilmour et al., 2000). It has been shown that regulation at the transcriptional level plays a major role in the integration of responses that lead to either short-term defenses or long-term adaptation (Fowler et al., 2005; Cook et al., 2004; Pearce, 1999). Extensive functional genomic studies in the plant genetic model Arabidopsis established a clear understanding of the transcriptional regulatory networks involved with CA, allowing a conceptual simplification of the otherwise complex phenomenon within the context of the function of a few transcription factors and their respective regulatory modules (reviewed by Van Buskirk and Thomashow, 2006; Thomashow, 1999, 2001). For instance, global analysis of the Arabidopsis transcriptome induced during CA identified several transcriptional regulatory modules that involve transcription factors such as CBF1, ZAT12, and RAV1 (Fowler and Thomashow, 2002). The CBF family of transcription factors regulates a large number of cold-regulated (COR) genes that contain the CRT/DRE cis-elements in their promoters and they play very important roles in the activation and integration of cellular defenses associated with various physiological and biochemical perturbations that occur during freezing. More recently, ZAT12 has been recognized as a potential regulator of additional genetic pathways within the global regulatory network that defines the CA response (Vogel et al., 2005; Fowler and Thomashow, 2002).

More recent comparative genomic studies revealed that the cold-stress-associated transcription factors have functional homologs even in plants that do not cold acclimate. An emerging theme based on comparative analysis of the Arabidopsis (freeze tolerant) and tomato (chilling sensitive) CBF regulons is that regulatory modules are evolutionarily conserved between the two groups of plants. It was proposed that the differences between the response mechanisms of Arabidopsis and tomato can probably be attributed to the high compositional complexity of the CBF genetic networks, hence a fully functional pathway in Arabidopsis, and limited compositional complexity of homologous networks, hence a partially functional pathway in tomato (Zhang et al., 2004). Guided by this reasoning, we conducted initial studies that aimed at reassessing the extent of variation for cold sensitivity in tuber-bearing Solanum species in both a physiological and a molecular context using our current knowledge of the function, regulation, and conservation of selected CA-associated genes. Our specific objective was to determine if the Solanum species representing the different levels of sensitivity across the spectrum of natural variation can be distinguished in terms of differential expression of CA-associated genes that are conserved between chilling-insensitive and chilling-sensitive species.

	MATERIALS AND METHODS

TOP NOTES ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
Plant Materials and Physiological Analysis
True seeds of wild Solanum species, that is, S. boliviense Dunal (PI 265860), S. commersonii Dunal (Oka 5040, PI 472833), S. trifidum Correll (PI 255541), S. polytrichon Rydb. (PI 184773), and S. stoloniferum Schltdl. & Bouché (PI 161770), were obtained from the Potato Germplasm Center (Madison, WI). Sterilized seeds (30% ethanol) were germinated and grown in MS-agar medium until ready for transplanting. Potted seedlings of wild species and potato cultivars established from tubers (S. tuberosum cv. Red Pontiac, Superior, Russet Burbank, and Kennebec) were grown in a controlled-environment room (24°C, 14/10-h day/night light cycle) for 8 wk. Plants were exposed to low-temperature conditions (chilling = 13°C, 14/10-h day/night light cycle; above freezing = 2°C, 14/10-h day/night light cycle) in a growth chamber for a period of 2 to 14 d for the cold sensitivity test and for a total duration of 20 d for CA (Chen and Li, 1980). For the freezing treatments, both acclimated (20 d at 2°C) and nonacclimated (20 d at 24°C) were exposed to –3°C in a low-temperature chamber for 30 min. For the high-NaCl and -mannitol stress experiments, plants that had been established in soil for 8 wk were carefully uprooted and transferred into hydroponic solution (0.25x standard Hoagland's medium). Plants were allowed to establish in hydroponics at a constant temperature of 24°C for an additional 4 d, after which the hydroponic solution was supplemented with NaCl or mannitol at 200 mmol/L final concentration. The plants were kept in the NaCl- or mannitol-supplemented medium for an additional 2 d before analysis.

Plants that were exposed to different stress regimes were analyzed for physiological injuries to the cell membrane by the electrolyte leakage assay (Sukumaran and Weiser, 1972). The relative differences in membrane injuries between species and potato cultivars under control and chilling, freezing, and NaCl and mannitol treatments were assessed by measuring foliar (leaf disks) electrical conductivity (Chen et al., 2006; Chen and Li, 1980).The electrolyte leakage percentage in the control (%EC_control) and treatment (%EC_treatment) plants was determined by the following equation: %EC = (EC_induced/EC_total)100, where EC_induced is the amount of electrolytes that leaked from the leaf disk sample after treatment and EC_total is the total tissue electrolytes measured after boiling the leaf disks for 1 h (complete leakage). Membrane injury in relative terms was expressed as an electrolyte leakage index (ELI), which is the ratio between %EC_treatment and %EC_control. Statistical analysis was performed with Statistix-8 (Analytical Software, Tallahassee, FL).

Gene Expression Analysis
Total RNA was isolated from leaf tissues with the Trizol reagent (Invitrogen, Carlsbad, CA). Expression of CA gene homologs was monitored in wild Solanum species and potato cultivars at different stress regimes either by semiquantitative (real-time polymerase chain reaction, RT-PCR) and quantitative real-time polymerase chain reaction (qPCR). Gene-specific primers were designed from available expressed sequence tags (ESTs) of Arabidopsis, potato, or other solanaceous plants. The sequences of the gene-specific primers are as follows: CBF1 (forward: CAGTATACAGGG GAGTCAGGATGAGGA, reverse: CTCTTAATGCTAAAGCTGCCACGTCAT); ZAT12 (forward: AAGATTCACGAGTGCTCGATTT, reverse: GCTTGCCTGAGAATTCAAACTT); COR47 (forward: CCAACGTGGAGGCTACTGAT, reverse: TTCTTCCTCCTCGTCACTCG); GolS2 (forward: CGTATTTGGGAGTTTGTGGAAT, reverse: TCCAGAGACTCGTCGTTGTAAA); GolS3 (forward: ATGCAGTGATGGATTGTTTCTG, reverse: CCCAAATACGGAGTTTGGAATA); and actin, a constitutive control (forward: TCTTTCGCTGTATGCCAGTG, reverse: CCATTCGCATCA GTGAAGGT).

For qPCR analysis (low-temperature stress), 2 µg of total RNA was reverse transcribed using an iScript cDNA Synthesis kit (Bio-Rad Laboratories, Hercules, CA) according to the manufacturer's instructions. Transcript (cDNA) amplification and quantification of the experimental genes were performed with three independent biological replications using the SYBR Green Fluorescein mix (ABgene, Rochester, NY) in the MyiQ single-color real-time PCR detection system (Bio-Rad Laboratories, Hercules, CA). For each reaction, 2 µL of the cDNA and 5 mg/L of each gene-specific primer were used in a 20µL cocktail. Relative expression of the experimental genes was determined using the Livak method, 2^–C_T (Bio-Rad Laboratories, 2004). Gene expression values were normalized with respect to a constitutive actin gene. Relative expression was based on the average obtained from independent biological replicates. Relative expression values of the control were set to zero by subtracting from the values of the treatments at each time point.

For the RT-PCR assay (NaCl and mannitol experiments), the cDNA templates were synthesized from 2 µg total RNA with the ImProm-II Reverse Transcription Kit (Promega, Madison, WI). Fragment amplification was performed on a 10x dilution of the cDNA solution (reverse transcription cocktail) using the PCR Master Mix (Promega, Madison, WI) for 24 cycles in the iCycler thermal cycler (Bio-Rad Laboratories, Hercules, CA). Cycling parameters for the 24-cycle RT-PCR were as follows: initial denaturation at 94°C (4 min), followed by 24 cycles of step denaturation at 94°C (1 min), primer annealing at melting temperature (1 min), and extension at 72°C (2 min). Final extension was performed at 72°C for an additional 5 min. The expression of the actin gene was used as a noninducible control. The specificity of the resulting RT-PCR fragments to the target gene(s) was further confirmed by cloning and sequencing. The RT-PCR analysis was performed with samples from three independent biological replicates.

	RESULTS AND DISCUSSION

TOP NOTES ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
Six wild Solanum accessions (S. commersonii, Oka 5040; S. commersonii, PI 472833; S. boliviense; S. polytrichon; S. trifidum; and S. stoloniferum) and four commercial potato cultivars (Red Pontiac, Superior, Kennebec, and Russet Burbank) were first compared with respect to their responses to different durations of exposure to chilling (13°C) and above-freezing (2°C) temperatures to establish the basal level of cold sensitivity. These accessions represent the presumed spectrum of cold sensitivity among the tuber-bearing Solanum species based on previously reported physiological evaluations (Chen and Li, 1980; Li, 1977; Sukumaran and Weiser, 1972). Tomato was used as a chilling-sensitive control. We revisited the previously established cold-sensitivity classification in an effort to develop a robust foundation for correlative analysis of physiological profiles and differential expression of CA-associated gene homologs in different Solanum species.

The ELI was used as a physiological parameter to establish the differences between species and cultivars in terms of the magnitude of injury to the cell membrane after exposure to chilling (13°C) or above-freezing (2°C) temperatures. This analysis method assumes that an ELI value close to 1 indicates no significant difference in electrolyte leakage between the treatment and control plants (no significant membrane damage). An ELI value >1 indicates higher electrolyte leakage in the treatment plants (significant membrane injury), which was then evaluated for statistical significance based on an arbitrary threshold.

Results of the ELI analysis indicated a gradient of cold sensitivity among the 10 species and cultivars included in the survey based on statistically significant deviation from an ELI cutoff value of 1.5 (Fig. 1 ). Based on this analysis, the relative cold-sensitivity ranking in this group of Solanum species was generally consistent with the previously established classification (Chen and Li, 1980). Under chilling conditions (13°C), only S. trifidum and tomato had detectable physiological injuries, as indicated by ELI values significantly greater than the cutoff even after a relatively short exposure (2 d). Under above-freezing conditions (2°C), S. trifidum also turned out to be the most fragile among the wild species, and hence was referred to as "highly cold sensitive." This species readily exhibited significant physiological injuries, as indicated by ELI values greater than the cutoff as early as 2 d after exposure to 2°C. Solanum trifidum and tomato, another chilling-sensitive solanaceous plant, exhibited comparable patterns of physiological injury during prolonged exposure to 2°C. At the end of the 14-d exposure to 2°C, both S. trifidum and tomato exhibited highly significant increases from the cutoff ELI value and were pale and slightly water soaked in appearance. Although significant injuries were detected in Kennebec and Red Pontiac, they were not as fragile as S. trifidum and tomato, as indicated by much-delayed timing of leakage (7 d). These cultivars have comparable levels of sensitivity and were placed under the same category of "cold-sensitive" genotypes.

View larger version (39K): [in this window] [in a new window]   Figure 1. Gradient of cold sensitivity in representative Solanum species based on electrolyte leakage analysis. Leakage of cellular electrolytes was measured on leaf disks of plants at the mid-vegetative stage before and after exposure to chilling (13°C, top panel) or above-freezing (2°C, bottom panel) temperatures. Electrolyte leakage index (ELI) is the cellular electrolyte leakage ratio between cold-treated and control plants. An ELI = 1 indicates no significant leakage of electrolytes due to cold, while ELI >1 indicates significant leakage due to cold. Means (±SE, n = 4) are significantly greater than 1.5 (arbitrary cutoff level) at P < 0.001 (***) or P < 0.01 (**).

The same group of 10 Solanum accessions and potato cultivars was also tested for their ability to cold acclimate by a brief (30-min) exposure to freezing after either 7 or 20 d of continuous exposure to 2°C (Fig. 2 ). For this assessment, we used a freezing temperature of –3°C based on the median temperature at which 50% of the plants were killed for a number of nonacclimated Solanum species established from the evaluation conducted by Chen and Li (1980). Results of this test showed that the ELI_freezing values of S. commersonii and S. polytrichon plants that had been exposed to acclimation temperature were significantly lower than the ELI_freezing values of plants that had not been acclimated (control). In the other eight accessions that are either cold sensitive or highly cold sensitive, the ELI_freezing values with acclimation (regardless of duration) were either similar to or greater than the values in the control. These results indicate that only S. commersonii and S. polytrichon showed indications of a cold-acclimation (CA) response and that the magnitude of reduction in freeze-induced membrane injury in these species appears to be proportional to the length of acclimation time. Although Superior, Russet Burbank, and Kennebec potato and S. boliviense did not acclimate, their injury levels at –3°C were somewhat lower than S. trifidum, S. stoloniferum, Red Pontiac potato, and tomato, suggesting a partial tolerance that appears to be independent of CA. A binary diagram shown in Fig. 3 summarizes the relative ranking of Solanum species based on sensitivity to chilling (13°C) and above-freezing (2°C) temperatures and ability to acclimate.

View larger version (40K): [in this window] [in a new window]   Figure 2. Cold acclimation (CA) response in Solanum species. Plants at the mid-vegetative stage were exposed to an above-freezing temperature (2°C) for a maximum of 20 d after establishment at a control temperature (24°C) and then exposed to freezing (–3°C) for 30 min. Electrolyte leakage index (ELI) is the cellular electrolyte leakage ratio between cold-treated and control plants. An ELI = 1 indicates no significant leakage of electrolytes due to cold, while ELI >1 indicates significant leakage due to the treatment. Means (±SE, n = 4) are significantly different between CA and non-CA plants at P < 0.001 (***) or P < 0.01 (**).

View larger version (21K): [in this window] [in a new window]   Figure 3. Binary diagram summarizing the gradient of cold sensitivity in Solanum species. In both the chilling (13°C) and above-freezing (2°C) temperature experiments, the accessions with statistically significant increases from the electrolyte leakage index (ELI) cutoff value of 1.5 at each time point were assigned a value of 1 (black), while those within or below the cutoff, a value of 0 (white).

As an initial effort to assess the extent and potential significance of differential gene expression to the observed gradient of cold sensitivity in Solanum species, we compared the activities of selected CA-associated gene homologs between wild and cultivated species that represent the extremes of the cold-sensitivity gradient as defined by the data from the physiological experiments (Fig. 1 and 2). In this analysis, we surveyed the expression profiles of two transcription factors (CBF1 and ZAT12) that have been shown to play important roles in configuring the CA transcriptome in Arabidopsis (Vogel et al., 2005) and representative downstream target genes COR47, GolS2, and GolS3 (Fowler and Thomashow, 2002). Expression of these genes was investigated by qPCR using either homologous or heterologous cDNA sequences as a basis for the gene-specific primers. Primers for CBF1 (BG590659) were based on the ESTs identified from pathogen-challenged and abiotic stress cDNA libraries of potato (Ronning et al., 2003). Primers for COR47 were based on an S. commersonii EST for dhn2 (CK275854) and an EST derived from an abiotic stress cDNA library of potato (CK275854; Rensink et al., 2005a, 2005b). Primers for ZAT12 were designed from a heterologous cDNA from Ipomoea trifida (Kunth) G. Don (AH013750). Expression of the galactinol synthase genes GolS2 (AB062848) and GolS3 (AB062850) was monitored using primers designed from full-length cDNAs of Arabidopsis. The specificity of all primers was validated by the correct sequence of single amplification products obtained from both genomic DNA and cDNA templates.

Solanum commersonii, Red Pontiac potato, and S. trifidum were used as the test genotypes for this analysis, representing three levels of cold sensitivity: cold acclimating and freeze tolerant, cold sensitive, and highly cold sensitive (or chilling sensitive), respectively. Gene expression analysis by qPCR was performed by monitoring transcript levels resulting from rapid (within the initial 24 h) and slow (after 24 h) responses to an above-freezing temperature (2°C). Under the specific conditions used in this experiment, CBF1 expression in S. commersonii was a two-phase induction event that occurred at 2 (rapid) and 48 h (slow) after the initiation of the cold treatment (Fig. 4 ). The first induction was very subtle and transient in comparison with the second induction, which was not only very pronounced (100-fold stronger) but was also more sustained, as indicated by the progressive increase in transcript level lasting for at least another 48 h. In contrast, induction of CBF1 in potato was detected, albeit at a very low level (almost at the basal level), only after 96 h of continuous exposure to 2°C. The CBF1 expression in S. trifidum was intermediate between S. commersonii and Red Pontiac, but unlike in S. commersonii, maximum induction in S. trifidum did not occur until 24 h after the initiation of the cold treatment and the magnitude of such induction was very weak and comparable only to the level observed in the first induction event (2 h) in S. commersonii.

View larger version (16K): [in this window] [in a new window]   Figure 4. Comparative analysis of cold-induced expression of selected cold acclimation (CA) associated gene homologs (CBF1, ZAT12, COR47, and GolS3). Three test genotypes or species at the extreme ends of the cold-sensitivity gradient, i.e., Solanum commersonii (cold acclimating and freeze tolerant), S. tuberosum cv. Red Pontiac (cold sensitive), and S. trifidum (highly cold sensitive, i.e., chilling sensitive) were compared by quantitative real-time polymerase chain reaction. Relative expression was based on the average obtained from independent biological replicates (±SE, n = 3).

It is apparent, based on these results, that the three Solanum species differing in their sensitivity to cold stress can be distinguished from each other by the expression profiles of major CA-associated transcription factors. There appears to be a positive correlation between CBF1 and ZAT12 expressions and the ability of S. commersonii but not potato or S. trifidum to cold acclimate. On the contrary, the differential induction patterns of CBF1 and ZAT12 between the two nonacclimating species were not consistent with the differences in the magnitude of cold sensitivity between these species. For instance, potato is less cold sensitive than S. trifidum but had lower activities (almost undetectable in this analysis) of CBF1 and ZAT12 than S. trifidum, which is the most cold sensitive (chilling intolerant) among the species that we surveyed. The biological implication of this reversed trend among nonacclimating species is unclear based on the current data alone. More extensive studies including the analysis of all CBF paralogs within each of these species may provide better resolution to this comparison. Nevertheless, given that about 100 genes have been putatively identified as direct targets of CBF1 and ZAT12 combined in Arabidopsis (Vogel et al., 2005; Fowler and Thomashow, 2002), the positively correlated physiological and transcript profiles in S. commersonii is quite interesting and suggests a number of possibilities. First, such correlation suggests that CBF1 and ZAT12 of S. commersonii function in a similar manner to their homologs in Arabidopsis in configuring the CA transcriptome. Second, the slow induction event in S. commersonii, which occurred within 48 h after the initiation of cold treatment and which was not pronounced in the nonacclimating species, may be an important mechanism for the robust expression of the downstream regulatory clusters during CA. Testing both of these hypotheses requires an extensive survey of the CA transcriptome of S. commersonii.

Given the species-specific expression profiles of the putative CBF1 and ZAT12 of Solanum, we then studied the expression of selected COR gene homologs (COR47, GolS2, and GolS3) in the same three test genotypes. Our assumption was that the timely and pronounced cold induction of CBF1 in S. commersonii would be manifested in terms of commensurate expression of COR genes. Based on the current results, the expression profile of COR47 in S. commersonii was consistent with this assumption, as indicated by its induction within the initial 12 h and progressive or sustained increase with longer exposure to low temperature (Fig. 4). This pattern appears to be a probable consequence of the two-phase induction of CBF1. Cold treatment also caused a significant induction of COR47 in Red Pontiac, albeit at a slightly lower magnitude and less sustained phase than the induction in S. commersonii. Considering that CBF1 was barely detectable in Red Pontiac, the induction of COR47 in this species could not be a consequence of CBF1 expression but possibly attributable to other transcription factors including other CBF paralogs that are also induced by cold. Similar generalization can be applied to S. trifidum, wherein CBF1 was significantly induced but COR47 was barely detectable. More direct biochemical and genetic evidence is required to determine if the homologous COR47 genes between these three Solanum species are regulated by the same or different transcription factors.

The expression of two stress-related galactinol sythase genes (GolS2 and GolS3) involved in the synthesis of the raffinose family of osmoprotectant oligosaccharides were also compared between the three test genotypes. The GolS2 expression was undetectable at all time points (data not shown) but GolS3 was induced by an above-freezing temperature and exhibited distinct profiles between S. commersonii, Red Pontiac, and S. trifidum (Fig. 4). This result was consistent with previous findings that GolS3 and GolS2 in Arabidopsis were specific to cold and dehydration or salt stress, respectively (Taji et al., 2002). Although Red Pontiac exhibited the earliest and strongest induction of GolS3, expression of the S. commersonii homolog appeared to be more robust and sustained. Solanum trifidum had the weakest and most delayed induction of GolS3. These results suggest potential differences in the activity of the transcription factor that regulates the homologous GolS3 genes in Solanum species.

Overall, the results of the comparative transcript profiling studies indicate that the cold-induced expression of transcription factors (CBF1 and ZAT12) is related to the differential ability of some Solanum species to cold acclimate but not to the differences in the magnitude of sensitivity to above-freezing temperatures among nonacclimating species. On the other hand, the expression of nonregulatory genes (COR47 and GolS3) seems to reflect the variation in cold sensitivity among the three test genotypes examined. Previous studies suggested that the partial functionality of the CBF regulon in chilling-sensitive tomato may be attributed either to the compositional complexity of the target clusters or to the differences in the promoter structures of target genes (Zhang et al., 2004). The significance of these findings to our current results in tuber-bearing Solanum species is unclear at this point. Analysis of a larger subset of genes by microarray is currently underway to further investigate the significance of the differences that we observed in this study.

Because of similar physiological effects of cold, dehydration, and high-salinity stress, we also performed a preliminary experiment to explore the possibility that the observed variation in cold sensitivity may be related to interspecific variation for tolerance to related stress factors. In this test, plants were subjected to artificial conditions that mimic the physiological effects of high salinity and dehydration (200 mmol/L of either NaCl or mannitol in hydroponics). Different Solanum accessions responded differently to high NaCl and mannitol treatments. Interestingly, the cold-sensitivity gradient within Solanum species appears to reflect the variation for sensitivity to high NaCl and mannitol (Fig. 5 ). For instance, S. commersonii (both accessions) and S. trifidum, the two species at the extreme ends of the cold-sensitivity gradient, also exhibited the lowest and highest levels of injury, respectively, in both the NaCl and mannitol experiments. The other three wild species (S. boliviense, S. polytrichon, and S. stoloniferum) with an above-freezing sensitivity level comparable to S. commersonii also exhibited insignificant injuries under high NaCl and mannitol treatments. The most cold-insensitive potato cultivars exhibited moderate to high injuries with respect to the low-sensitivity (S. commersonii) and high-sensitivity (S. trifidum) standards.

View larger version (26K): [in this window] [in a new window]   Figure 5. Differential responses of Solanum species to high concentrations of NaCl (200 mmol/L) and mannitol (200 mmol/L) in hydroponics. Relative ranking for osmotic or high-salt sensitivity is very similar to the cold-sensitivity ranking. Electrolyte leakage index (ELI) is equal to the ratio of the cellular electrolyte leakage percentage between experimental (treatment) and control plants. An ELI = 1 indicates no significant leakage of electrolytes due to treatment, while ELI >1 indicates significant leakage due to the treatment. Means (±SE, n = 5) are significantly greater than 1.5 (cutoff level) at P < 0.001 (***) or P < 0.01 (**).

View larger version (52K): [in this window] [in a new window]   Figure 6. Comparative analysis of the NaCl–- and mannitol-induced expression of CBF1, GolS2, and GolS3 homologs in Solanum species: C = control, M = mannitol, S = NaCl. Gene expression analysis was performed after 2 d of exposure to a high concentration of NaCl (200 mmol/L) or mannitol (200 mmol/L) in hydroponics. Expression analysis was performed by semiquantitative real-time polymerase chain reaction. Gel images were representatives of the profiles from three independent biological replicates with two technical replicates each.

	ACKNOWLEDGMENTS

 
This project was supported by the Maine Agricultural and Forestry Experiment Station (MAFES no. 2950) and the Maine Potato Board.

	NOTES

TOP NOTES ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 
All rights reserved. No part of this periodical may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Permission for printing and for reprinting the material contained herein has been obtained by the publisher.

Received for publication January 22, 2007.

	REFERENCES

TOP NOTES ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION REFERENCES

 

• Bamberg, J.B., J.P. Palta, and S.E. Vega. 2005. Solanum commersonii cytoplasm does not improve freezing tolerance in substitution backcross hybrids with frost-sensitive potato species. Am. J. Pot. Res. 82:251–254.
• Bio-Rad Laboratories. 2004. Real-time PCR applications guide. Bio-Rad Laboratories, Hercules, CA.
• Carputo, D., A. Terra, A. Barone, F. Exposito, V. Fogliano, L. Monti, and L. Frusciante. 2003. Glycoalkaloids and acclimation capacity of hybrids between Solanum tuberosum and the incongruent hardy species S. commersonii. Theor. Appl. Genet. 107:1187–1194.[CrossRef][Web of Science][Medline]
• Chen, H.H., and P.H. Li. 1980. Characteristics of cold acclimation and deacclimation in tuber-bearing Solanum species. Plant Physiol. 65:1146–1148.[Abstract/Free Full Text]
• Chen, Y., P. Chen, and B.G. de los Reyes. 2006. Differential responses of cultivated and wild species of soybean to dehydration stress. Crop Sci. 46:2041–2046.[Abstract/Free Full Text]
• Cook, D., S. Fowler, O. Fiehn, and M.F. Thomashow. 2004. A prominent role for the CBF cold response pathway in configuring the low-temperature metabolome of Arabidopsis. Proc. Natl. Acad. Sci. 101:15243–15248.[Abstract/Free Full Text]
• Fowler, S., D. Cook, and M.F. Thomashow. 2005. Low temperature induction of Arabidopsis CBF1, 2, and 3 is gated by the circadian clock. Plant Physiol. 137:961–968.[Abstract/Free Full Text]
• Fowler, S., and M.F. Thomashow. 2002. Arabidopsis transcriptome profiling indicates that multiple regulatory pathways are activated during cold acclimation in addition to the CBF cold response pathway. Plant Cell 14:1675–1690.[Abstract/Free Full Text]
• Gilmour, S.J., A.M. Sebolt, M.P. Salazar, J.D. Everard, and M.F. Thomashow. 2000. Overexpression of the Arabidopsis CBF3 transcriptional activator mimics multiple biochemical changes associated with cold acclimation. Plant Physiol. 124:1854–1865.[Abstract/Free Full Text]
• Hawkes, J.G. 1990. The potato: Evolution, biodiversity and genetic resources. Belhaven Press, London.
• Li, P.H. 1977. Frost killing temperatures of 60 tuber-bearing Solanum species. Am. Pot. J. 54:452–456.
• Liu, Q., M. Kasuga, Y. Sakuma, H. Abe, S. Miura, K. Yamaguchi-Shinozaki, and K. Shinozaki. 1998. Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA binding domain separate two cellular signal transduction pathways in drought- and low-temperature-responsive gene expression, respectively in Arabidopsis. Plant Cell 10:1391–1406.[Abstract/Free Full Text]
• Pearce, R.S. 1999. Molecular analysis of acclimation to cold. Plant Growth Reg. 29:47–76.[CrossRef][Web of Science]
• Rensink, W., A. Hart, J. Liu, S. Ouyang, V. Zismann, and C.R. Buell. 2005a. Analyzing the potato abiotic stress transcriptome using expressed sequence tags. Genome 48:598–605.[Medline]
• Rensink, W.A., Y. Lee, J. Liu, S. Lobst, S. Ouyang, and C.R. Buell. 2005b. Comparative analyses of six solanaceous transcriptomes reveal a high degree of sequence conservation and species-specific transcripts. BMC Genomics 6:124.[CrossRef][Medline]
• Ronning, C.M., S.S. Stegalkina, R.A. Ascenzi, O. Bougri, A.L. Hart, T.R. Utterbach, et al. 2003. Comparative analyses of potato expressed sequence tag libraries. Plant Physiol. 131:419–429.[Abstract/Free Full Text]
• Shinozaki, K., and K. Yamaguchi-Shinozaki. 2000. Molecular responses to dehydration and low temperature: Differences and cross-talk between two stress signaling pathways. Curr. Opin. Plant Biol. 3:217–223.[Web of Science][Medline]
• Stockinger, E.J., S.J. Gilmour, and M.F. Thomashow. 1997. Arabidopsis thaliana CBF1 encodes an AP2 domain-containing transcription activator element that binds to the C-repeat/DRE, a cis-acting regulatory element that stimulates transcription in response to low temperature and water deficit. Proc. Natl. Acad. Sci. 94:1035–1040.[Abstract/Free Full Text]
• Sukumaran, N.P., and C.J. Weiser. 1972. An excised leaflet test for evaluating potato frost tolerance. HortScience 7:467–468.
• Taji, T., C. Ohsumi, S. Iuchi, M. Seki, M. Kasuga, M. Kobayashi, K. Yamaguchi-Shinozaki, and K. Shinozaki. 2002. Important roles of drought- and cold-inducible genes for galactinol synthase in stress tolerance in Arabidopsis thaliana. Plant J. 29:417–426.[CrossRef][Web of Science][Medline]
• Thomashow, M.F. 1999. Plant cold acclimation: Freezing tolerance genes and regulatory mechanisms. Annu. Rev. Plant Physiol. Plant Mol. Biol. 50:571–599.[CrossRef][Web of Science][Medline]
• Thomashow, M.F. 2001. So what's new in the field of plant cold acclimation? Lots! Plant Physiol. 125:89–93.[CrossRef]
• Van Buskirk, H.A., and M.F. Thomashow. 2006. Arabidopsis transcription factors regulating cold acclimation. Physiol. Plant. 126:72–80.[CrossRef]
• Vega, S.E., A.H. del Rio, J.B. Bamberg, and J.P. Palta. 2004. Evidence for the upregulation of stearoyl-ACP (9) desaturase gene expression during cold acclimation. Am. J. Pot. Res. 81:125–135.
• Venema, J.H., P. Linger, A.W. van Heusden, P.R. van Hasselt, and W. Bruggeman. 2005. The inheritance of chilling tolerance in tomato (Lycopersicon spp.). Plant Biol. 7:118–130.[CrossRef][Medline]
• Vogel, J.T., D.G. Zarka, H.A. Van Buskirk, S.G. Fowler, and M.F. Thomashow. 2005. Roles of the CBF2 and ZAT12 transcription factors in configuring the low temperature transcriptome of Arabidopsis. Plant J. 41:195–211.[CrossRef][Web of Science][Medline]
• Zhang, X., S.G. Fowler, H. Cheng, Y. Lou, S.Y. Rhee, E.J. Stockinger, and M.F. Thomashow. 2004. Freezing-sensitive tomato has a functional CBF cold response pathway, but a CBF regulon that differs from that of freezing-tolerant Arabidopsis. Plant J. 39:905–919.[CrossRef][Web of Science][Medline]

This Article Abstract Figures Only Full Text (PDF) Free Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Ballou, S. M. Articles by de los Reyes, B. G. Search for Related Content PubMed Articles by Ballou, S. M. Articles by de los Reyes, B. G. Agricola Articles by Ballou, S. M. Articles by de los Reyes, B. G. Related Collections Gene Expression Plant and Environment Interactions