Published online 30 July 2007
Published in Crop Sci 47:1698-1704 (2007)
© 2007 Crop Science Society of America
677 S. Segoe Rd., Madison, WI 53711 USA
GENOMICS, MOLECULAR GENETICS & BIOTECHNOLOGY
Effect of Temperature on Delta-9 Stearoyl-ACP and Microsomal Omega-6 Desaturase Gene Expression and Fatty Acid Content in Developing Soybean Seeds
Grace E. Byfielda and
Robert G. Upchurchb,*
a Microbiology Dep., North Carolina State Univ., Raleigh, NC 27695
b USDA-ARS Soybean and Nitrogen Fixation Unit and Plant Pathology Dep., North Carolina State Univ., Raleigh, NC 27695
* Corresponding author (greg_upchurch{at}ncsu.edu).
 |
ABSTRACT
|
|---|
Delta-9 stearoyl-ACP (SAD) and microsomal omega-6 oleate (FAD2) desaturases contribute to the maintenance of lipid fluidity in membranes and the fatty acid composition of storage lipids in seed. Since these enzymes must operate at varying environmental temperatures, they are under constitutive control, but they may also be subject to fine regulation both transcriptionally and posttranscriptionally. We measured transcript accumulation of the seed-expressed SAD-A and SAD-B and FAD2-1A and FAD2-1B genes in the seeds of three soybean varieties grown at cool (22/18°C), normal (26/22°C), or warm (30/26°C) temperatures during pod fill. At the cool temperature, transcript accumulation of both the SAD and FAD2-1 genes was significantly elevated, with FAD2-1B 2- to 10-fold or greater than FAD2-1A at 35 d after flowering. Expression of both SAD and FAD2-1 were significantly decreased in seed that developed at the warm temperature. Decreased FAD2-1 transcript accumulation at the warm temperature was positively associated with significantly increased oleic and decreased linoleic acid content in the three varieties examined. Decreased SAD transcript accumulation at the warm temperature was positively associated with a significantly increased level of stearic acid but only in the high-stearate mutant line, A6. We conclude that environmental temperature modulates oleic and linoleic acid in developing seed through regulated FAD2-1 gene expression, but temperature modulation of stearic acid content in wild-type soybean may be more complex, involving in addition to SAD-A and -B, plastid thioesterase genes FATA and FATB.
Abbreviations: ACP, acyl-acyl carrier protein DAF, days after flowering D/N, day/night FAD2-1, Glycine max microsomal omega-6 fatty acid desaturase FAME, fatty acid methyl ester PCR, polymerase chain reaction RT-PCR, reverse transcription–polymerase chain reaction SAD, Glycine max delta-9 stearoyl acyl carrier protein desaturase
 |
INTRODUCTION
|
|---|
SOYBEAN [Glycine max (L.) Merr.] is the largest oilseed crop produced and consumed worldwide, accounting for 56% of the world oilseed production in 2003 (American Soybean Association, 2004). Oilseeds provide high-protein feed for livestock and poultry, and are used extensively in the cooking and food manufacturing industries around the world. Soybean seed is approximately 18% oil, and standard commodity soybean oil a mixture of five fatty acids: palmitic (11%), stearic (4%), oleic (22%), linoleic (53%), and linolenic (8%). These fatty acids differ greatly in melting points, oxidative stabilities, and chemical functionalities (Cahoon, 2003). The stability of soybean oil could be improved by increasing the oleic acid content through manipulation of genes integral to the C18 desaturase pathway (Kinney, 1997; Buhr et al., 2002; Wilson, 2004). Higher oleic oil possesses increased oxidative stability, which negates the need for hydrogenation and eliminates the production of trans fats that are a major concern for cardiovascular health.
Soluble delta-9 stearoyl-ACP desaturases (SADs) are found in all plant cells and are essential for the biosynthesis of unsaturated membrane lipids. This enzyme introduces the first double bond into stearoyl-ACP (18:0-ACP) between carbons 9 and 10 to produce oleoyl-ACP (18:1
9-ACP). SAD is unique to the plant kingdom since all other known desaturases are integral membrane proteins (Ohlrogge and Browse, 1995). In addition, SAD occupies a key position in C18 fatty acid biosynthesis since perturbation of SAD gene expression and/or enzyme activity may modulate the relative levels of both stearic and oleic acid in the oil. Two genes encoding SADs in soybean were recently cloned by polymerase chain reaction (PCR) using primers designed to a G. max SAD seed-expressed cDNA sequence (Byfield et al., 2006). SAD-A and -B transcripts were most highly expressed in seed tissues during seed development, but differences between SAD-A and -B transcript abundance in seed, while quantifiable, were not dramatic. A survey of the genomes of 51 soybean lines and cultivars with PCR and the gene-specific primers indicated that all 51 had both SAD-A and -B.
The microsomal omega-6 desaturase (FAD)-catalyzed pathway is the primary route of polyunsaturated lipid production in plants. This membrane-bound enzyme catalyzes the first extra-plastidial desaturation and converts oleic acid esterified to phosphatidylcholine to linoleic acid. Arabidopsis thaliana has a single FAD2 gene that is expressed both in vegetative tissues and developing seeds (Okuley et al., 1994). This gene is likely responsible for the conversion of oleic to linoleic acid in both the vegetative and seed storage tissues of Arabidopsis. Two different FAD genes, FAD2-1 and FAD2-2, were identified in soybean (Heppard et al., 1996). FAD2-1 is specifically expressed in developing seed and not in vegetative tissues, while FAD2-2 is constitutively expressed in both vegetative tissue and developing seeds. Although FAD2-2 contributes to the production of linoleic acid in all tissues, transcript expression analysis suggests that FAD2-1 plays the major role in the conversion of oleic acid to linoleic acid within storage lipids during the midmaturation stages of seed development because the expression level of FAD2-1 is much higher than that of FAD2-2 during this period of maximal storage lipid biosynthesis. Recently, two soybean seed-specific isoforms, A and B, of the original FAD2-1 gene, differing in 24 amino acid residues, were isolated and characterized (Tang et al., 2005). FAD2 genes showing tissue-specific expression have also been identified in cotton (Gossypium hirsutum L.) (Liu et al., 1997) and sunflower (Helianthus annuus L.) (Martinez-Rivas et al., 2001).
Plants must acclimate to changes in environmental temperature. In so doing they must maintain cellular membrane fluidity to provide a milieu suitable for the function of integral proteins and enzymes. Not surprisingly, a strong association has been observed between environmental temperature and the fatty acid content of both membrane and storage lipids in plant tissues. For example, monounsaturated fatty acids are observed to increase (Wolf et al., 1982) and polyunsaturated fatty acids decrease in storage lipids with increasing temperature during soybean pod fill (Neidleman, 1987; Rennie and Tanner, 1989; Thompson, 1993; Gibson and Mullen, 1996). Early research suggested that fatty acid desaturases may mediate the response of plants to high and low growth temperatures (MacCarthy and Stumpf, 1980a, 1980b). Cheesbrough (1989) demonstrated that the activities of both microsomal oleoyl (omega-6) and linoleoyl (omega-3) desaturases significantly decreased in soybean cell suspension cultures with increasing incubation temperature. Other mechanisms are also likely involved in the response of plant desaturases to temperature. These include the modulation of desaturase enzyme content in tissues through transcriptional and posttranscriptional control (Murphy and Piffanelli, 1998). In maize, the transcript accumulation of a plastid-localized omega-3 desaturase gene increased in response to growth at low temperature, suggesting regulation at the gene transcription level (Berberich et al., 1998). In contrast, the membrane-associated omerga-3 desaturase of wheat showed increased enzyme accumulation with increased linolenic acid production at low growth temperature, but in the absence of significant changes in transcript abundance (Horiguchi et al., 2000). Transcript levels of one of the two omega-3 desaturases in Arabidopsis, FAD8, decreased dramatically in response to growth at elevated temperature, but accumulation of the other, FAD7, remained unchanged (Gibson et al., 1994). FAD7 enzyme was later reported to be specifically destabilized by high temperature, suggesting regulation by a posttranscriptional mechanism (Matsuda et al., 2005). A posttranscriptional control mechanism also appears likely for the temperature-dependent regulation of the Arabidopsis FAD2-encoded omega-6 desaturase. Functional FAD2 gene has been shown to be required for normal Arabidopsis growth at low temperature (Miquel et al., 1993), but no changes in FAD2 transcript levels were observed when plants were transferred from 22 to 6°C (Okuley et al., 1994). Heppard et al. (1996) found that the linoleic acid level increased as temperature decreased in soybean seed 26 d after flowering (DAF), but that this change was not accompanied by any corresponding change in FAD2-1 transcript accumulation as determined by RNA gel blot analysis. Using heterologous expression in yeast, Tang et al. (2005) demonstrated that two posttranscriptional mechanisms were involved in the temperature regulation of the two soybean isoforms of FAD2-1. They found that FAD2-1A was less stable and had a higher protein turnover rate than FAD2-1B in cultures maintained at elevated growth temperatures. In addition, a specific serine residue was identified in both FAD2-1 sequences that, when phosphorylated, might downregulate enzyme activity.
Other genes likely influence the stearic and oleic acid content of storage lipid in developing soybean seeds. Plastid-localized acyl-acyl carrier protein (ACP) thioesterase enzymes terminate chain elongation by hydrolyzing the newly formed acyl-ACP into free fatty acids and ACP (Jones et al., 1995; Ohlrogge and Browse, 1995). Subsequently, the free fatty acids may exit the plastid to take part in further lipid biosynthesis. Acyl-ACP thioesterase FATB hydrolyzes palmitoyl-ACP and stearoyl-ACP to, respectively, palmitic and stearic acid. Acyl-ACP thioesterase FATA hydrolyzes oleoyl-ACP to oleic acid and ACP. Up- or downregulation of the expression of the acyl-ACP thioesterase FATB gene by temperature could result in increased or decreased stearic (and palmitic) acid content in soybean oil. Similarly, temperature regulation of FATA gene expression could result in altered oleic acid content in soybean oil.
In this study, we used gene-specific primers and real-time, reverse transcription–polymerase chain reaction (RT-PCR) to examine and reexamine the effect of temperature on the expression of the newly characterized SAD-A and -B and FAD2-1A and -1B genes in developing soybean seeds during the period of maximal storage lipid biosynthesis. For this purpose, total RNA was extracted from seeds produced under three air temperature regimes. Fatty acid composition of the seeds was analyzed so that we could identify associations between temperature, desaturase gene expression, and an estimate of the in vivo synthesis of stearic, oleic, and linoleic acid in the developing seed.
 |
MATERIALS AND METHODS
|
|---|
Plant Varieties and Growth Conditions
Glycine max lines were chosen for this study based on seed fatty acid composition at maturity. Fatty acid analysis of seeds of the maturity group V soybean cultivar Dare (Brim, 1966) indicated 3% 18:0, 21% 18:1, 58% 18:2, of the maturity group 0 high-stearate mutant A6 (Hammond and Fehr, 1983), 22% 18:0, 22% 18:1, 43% 18:2, and of the maturity group IV mid-oleic line N01-3544 (Burton et al., 2005), 3% 18:0, 52% 18:1, 33% 18:2. Seeds were supplied by J.W. Burton, USDA-ARS, Raleigh. Plants were grown in semicontrolled chambers at the Southeastern Plant Environment Laboratory (Phytotron) at N.C. State University, Raleigh, N.C. Pregerminated seeds were planted in 25-cm pots containing standard mix (1/3 peat-lite and 2/3 gravel), and five plants of each variety were grown in a random arrangement in each of three chambers. Chambers were initially maintained at a day/night (D/N) temperature of 26/22°C (normal) with 14 h of incandescent light and 10 h of darkness interrupted by a 1-h period of light to synchronize plant development and flowering. Plants were watered twice daily with deionized water, and nutrient solution was supplied thrice per week. On Day 15, the light interruption was stopped and chambers were reset to D/N = 12/12 h to induce flowering. On Day 36, temperatures were changed in two chambers: one to 22/18°C (cool), D/N = 12/12, and the other to 30/26°C (warm), D/N = 12/12. These temperatures were maintained to the end of the experiment. Seeds were harvested at four developmental stages between R5 (beginning of seed set) and R6 (mature bean) coinciding with 18, 23, 28, and 35 DAF from three plants of each variety in each chamber and quickly flash frozen in liquid nitrogen and stored at –80°C.
RNA Isolation and Real-Time RT-PCR
RNA extraction was done on three seed samples for each of the four developmental stages. The Qiagen RNeasy Plant Mini kit (Valencia, CA) and the manufacturer's protocol were used to isolate total RNA from 100 mg of frozen powdered tissue per sample. All samples were DNase treated with Ambion DNA-free (Houston, TX) according to the manufacturer's directions. RNA concentrations were determined using a DU-640 spectrophotometer (Beckman Coulter, Fullerton, CA) set at absorbance 260 nm. Aliquots of RNA (free of genomic DNA) were diluted to 50 ng/µL in RNase-free water and stored at –80°C until use. To verify RNA integrity, 500 ng of total RNA of each sample was visualized on a 1% agarose gel following electrophoresis and staining with ethidium bromide.
Real-time, RT-PCR was performed with the iCycler (Bio-Rad, Hercules, CA) using the SYBR Green RT-PCR kit (Qiagen) to quantify SAD, FAD2-1 and soybean actin transcripts. Real-time primer sets for SAD-A and -B and actin were developed by Byfield et al. (2006). Primer set A, F-5'CCTGTTTGATAACTACTCTGCC3' and R-5'TCTTCCCTCACCTGAAAGTCCG3', produces a 133-bp SAD-A amplicon. Primer set B, F-5'CCTGTTTGATAGCTACTCTTCG3' and R-5'GTTAGCTGCTCCACCTCC3', produces a 111-bp SAD-B amplicon. The primer set specific for the housekeeping gene, actin, was F-5'GAGCTATGAATTGCCTGATGG3' and R-5'CGTTTCATGAATTCCAGTAGC3', derived from GenBank accession number U60500 (Moniz de Sa and Drouin, 1996), and produces a 118-bp amplicon. A typical reaction, done in duplicate, contained 12.5 µL of 2X SYBR Green PCR master mix, 250 nM each primer, 0.25 µL RT mix, 250 ng total RNA, and nuclease-free water to 25 µL. Conditions for reverse transcription and amplification were 50°C for 30 min followed by 95°C for 15 min, then 40 cycles of 15 s at 94°C, 30 s at 60°C, and 30s at 72°C. A melt-curve analysis over a 10°C temperature gradient at 0.05°C s–1 from 78° to 88°C was done after amplification to verify that a single product was produced in each reaction.
An original set of FAD2-1 primers, F-5'CACCTACTTCCACCTCCTTC3' and R-5'CACCCTCAATACCTTCAAAACA3', was designed based on the published sequence for the Glycine max FAD2-1 seed-expressed, microsomal omega-6 desaturase mRNA (Genbank accession no. L43920, Heppard et al., 1996). We used these primers to amplify FAD2-1 sequences from 16 soybean varieties using genomic templates. Sequence alignments of the FAD2-1 products revealed that the sequences could be placed into two consensus groups, similar to the results of Tang et al. (2005) from their investigation of microsomal omega-6 desaturase expressed sequence tags (ESTs). We used their findings to classify our sequences as either FAD2-1A or FAD2-1B. Using the FAD2-1 sequence information, we designed primers for the real-time quantification of transcripts of the two FAD2-1 genes. PCR with primer pair F-5'CCAATGGGTTGATGATGTTG3' and R-5'GTTGTTTAAGTACTTGGAAA3' is specific for the amplification of FAD2-1A and produces a 178-bp amplicon. A second primer pair, F-5'TTGACCGTTCACTCAGCAC3' and R-5'GGTTGTTCAGGTACTTGGTGT3', is specific for FAD2-1B and produces a 154-bp amplicon. A typical real-time RT-PCR reaction for FAD2-1 transcript quantification was done as previously described for SAD except the amplification conditions were 40 cycles of 15 s at 94°C, 30 s at 56.5°C, and 30s at 72°C, followed by the melt-curve analysis.
SAD, FAD2-1, and actin transcript abundance was mathematically determined by comparison of individual PCR cycle threshold values with a standard curve generated from serial dilutions of the respective authentic transcript fragment. Control reactions with RNA template but without reverse transcriptase amplified no product. Copy number, initially determined per microgram of total RNA, was normalized to the expression level (copy number) of the soybean actin gene.
Analysis of Oil and Fatty Acid Content
Seed samples used for RNA extraction were also the source material for oil and fatty acid analysis. Oil content of soybean seeds was determined by pulsed proton NMR using a Maran pulsed NMR (Resonance Instruments, Witney, Oxfordshire, UK) by the field induction decay-spin echo procedure of Rubel (1994). Oil and moisture content were measured and oil (% dry wt.) was determined by correcting for moisture content. Oil data were expressed as milligrams of oil per gram of seed. Fatty acid methyl esters (FAMEs) of the seed samples were prepared using acid methanolysis. Powdered seed tissue was heated to and held at 85°C for 90 min in a 5% HCl 95% methanol solution. FAME was partitioned two times into hexane and transferred to 2-mL vials for analysis. The FAMEs were separated by gas chromatography using an HP 6890 GC (Agilent Technologies, Inc., Wilmington, DE) equipped with a DB-23 30-m x 0.53-mm column (same source). Operating conditions were 1-µL injection volume, a 20:1 split ratio, and He carrier gas flow of 6 mL min–1. Temperatures were 250°C, 200°C, and 275°C for the injector, oven, and field induction decay-spin echo procedure, respectively. Chromatograms were analyzed using HP ChemStation software (Agilent Technologies, Santa Clara, CA), and fatty acid contents were calculated as a fraction of seed dry weight and expressed as milligrams of fatty acid per gram of seed.
Statistical Analysis
The accumulation of desaturase transcripts and the accumulation of stearic, oleic, and linoleic acid in seed across temperatures was statistically analyzed for significance (ANOVA) on-line at www.physics.csbsju.edu/stats/anova.html (verified 20 Apr. 2007).
 |
RESULTS
|
|---|
Effect of Temperature on Stearic, Oleic, and Linoleic Acid Content in Developing Seed
The stearic, oleic, and linoleic acid content in seeds 28 and 35 DAF is shown in Table 1. The effect of the warm environment on mean stearate accumulation in developing seeds varied with soybean variety. No statistically significant changes (p < 0.05) in stearic acid content related to temperature treatments were measured in the seeds of Dare and N01-3544 at 28 and 35 DAF. Across the three temperature environments, the seeds of A6 had the highest stearate content, and mean stearic acid content in A6 seeds from the warm environment increased by 40.4 mg g–1 seed at 35 DAF. The data revealed that temperature modulated the accumulation of oleate and linoleate in the developing seeds of the three varieties in a similar and statistically significant (p < 0.05) way: as temperature increased from the cool to the warm, oleate content increased and linoleate content decreased. The increase in mean oleic acid content (combined means of 28 and 35 DAF) was greatest in seeds of the mid–oleic acid line N01-3544, where a gain of approximately 57.0 mg oleate g–1 seed was measured in the warm environment. The decrease in mean linoleic acid content (combined means of 28 and 35 DAF) was greatest in seeds of the high-stearate mutant A6, where a loss of 44.2 mg linoleate g–1 seed was measured in the warm environment. Although similar trends with respect to temperature effects on seed fatty acid content were seen at the earlier developmental states (18 and 23 DAF), the data (not shown) were not statistically significant (p > 0.05).
View this table:
[in this window]
[in a new window]
|
Table 1. Effect of temperature environment (cool, normal, warm) during pod fill on the mean stearic (C18:0), oleic (C18:1), and linoleic (C18:2) acid content (mg g–1 seed) of developing soybean seed of varieties Dare, A6, and N01-3544 at 28 and 35 d after flowering (DAF).
|
|
Effect of Temperature on SAD and FAD2-1 Expression in Developing Seed
SAD and FAD2-1 transcript accumulation data, normalized to soybean actin, for 28 and 35 DAF are shown in Table 2. The data reveal that temperature regulates the accumulation of these desaturase gene transcripts in the developing seeds of all three varieties in a consistent manner: more transcript accumulation at the cool temperature and less at the warm temperature. The data, with one exception, are statistically significant (p < 0.05) for the effect of temperature on desaturase transcript accumulation.
View this table:
[in this window]
[in a new window]
|
Table 2. Effect of temperature environment (cool, normal, warm) during pod fill on the mean expression (normalized to actin) of the SAD and FAD2-1 genes in developing soybean seed of varieties Dare, A6, and N01-3544 at 28 and 35 d after flowering (DAF).
|
|
Transcript accumulation from SAD-A and -B and FAD2-1A and -1B decreased significantly when seeds of the three soybean varieties developed in the warm compared to the cool environment. SAD-A and -B transcript accumulations were essentially equal (and decreasing) from the cool to the warm environment, whereas FAD2-1B transcript accumulation was 2- to 10-fold or greater than that of FAB2-1A at each temperature. Stearic acid content was significantly elevated (Table 1), and SAD-A and -B transcript accumulation decreased in seeds of mutant A6 that develop in the warm compared to the cool environment. However, stearic acid content remained relatively constant (Table 1), while SAD-A and -B transcript accumulation decreased in seeds of cultivar Dare and mid-oleic line N01-3544 that developed in the warm compared to the cool environment. Oleic acid content increased in the seed of all three varieties that develop in the warm temperature. Linoleic acid content and FAD2-1 transcript accumulation both decreased in seeds of all three soybean varieties that developed in the warm environment.
 |
DISCUSSION
|
|---|
Using real-time RT-PCR we found that varying temperature during soybean seed development modulated the transcript accumulation of the seed-expressed, delta-9 stearoyl-ACP SAD-A and -B genes. At 28 and 35 DAF, the expression of these genes was significantly upregulated by the cool temperature (22/18°C) treatment in the three soybean varieties we examined. Before this result, we could find no published account of the regulation of a seed-expressed SAD by temperature. However, current research does suggest that upregulation of SAD transcript accumulation with presumably increased desaturase enzyme accumulation may enhance cold tolerance in plants. In this context, stearate content in cell membranes would be lowered, and oleate and ultimately polyunsaturated fatty acids elevated to maintain fluidity. The conversion of stearate to oleate in membrane lipids is essential for the conversion of the physical state of a membrane from the low-temperature-induced gel state to the liquid-crystalline state required for the maintenance of key enzyme function. Research by Vega et al. (2004) suggested that cold acclimation in potato plant leaves involves the response of SAD gene expression to cold temperatures. Using RT-PCR to quantify transcript accumulation, they found that SAD gene expression increased when young potato leaves of a cold-tolerant species of potato were exposed to cold temperatures, but not in a cultivated nonacclimating species. Research has shown that the stearic/oleic fatty acid content of soybean seed is modulated by temperature. Wilson and Burton (1993) found that stearic acid in the triacylgylcerol fraction from A6 seeds decreased at lower temperature (22/18°C). They speculated that the decreased stearate content might be due to low-temperature modulation of SAD enzyme activity. We found that the stearic acid content of A6 seeds measured on a per grams of seed basis, in agreement with this study, increased in the warm environment. A plausible explanation for this observation is that the increased in vivo accumulation of stearate in A6 may be the result of the warm-temperature-mediated decrease in SAD transcript accumulation that we observed. Conversely, the decline of stearate in A6 seed at low temperature may result from increased SAD-A and -B gene expression at the cool temperature. The stearate content of Dare and mid-oleic line N01-3544 seed, on the other hand, remained statistically unchanged across temperature environments, while the oleic acid content in these seeds increased in the warm environment. Since SAD transcript accumulation in Dare and N01-3544 seeds also decreased in the warm environment but with negligible affect on seed stearate content, we suggest that control of stearate by temperature may involve the regulated expression of other genes besides SAD-A and -B in wild-type soybeans. The expression levels of acyl-ACP thioesterase genes FATB and FATA may significantly affect oil composition since FATB competes with SAD for the 18:0-ACP substrate and FATA competes with FAD2-1 for the 18:1-ACP substrate. Future studies addressing the effect of temperature on thioesterase gene expression may expand and clarify our understanding of the mechanisms that control stearate and oleate accumulation in response to elevated temperature.
Temperature has also been shown to modulate the oleic acid content and the transcript abundance of genes in developing soybean seeds. Rennie and Tanner (1989) demonstrated that the oleic acid content in A6 seeds increased with increasing growth temperature. Thomas et al. (2003) also showed that oleic acid increased with increasing temperature, but linoleic acid decreased. Using differential mRNA display they demonstrated that transcripts of the auxin-regulated gene ADR12 and beta-glucosidase, a gene expressed during normal soybean development, were more highly expressed in seeds grown at the cool temperature (28/18°C) than at 40/30°C. Their results confirmed previous studies showing that higher temperatures altered soybean seed fatty acid composition and suggested that transcript regulation may be one mechanism by which seed oleate and linoleate content are adjusted to meet changes in environmental temperature to maintain a viable program of seed development. With real-time RT-PCR we found that varying the environmental temperature during soybean seed development also modulated the transcript accumulation of the seed-specific microsomal omega-6 desaturase genes FAD2-1A and -1B. At 28 and 35 DAF, FAD2-1A and -1B transcript accumulation decreased significantly in seeds that developed in the warm (30/26°C) environment (Table 2). The in vivo accumulation of oleic acid increased and linoleic acid decreased in seeds of each of the three varieties examined in this environment (Table 1). We found that the transcript accumulation of FAD2-1B was approximately 2- to 10-fold greater than FAD2-1A at each temperature studied. This observation may indicate that FAD2-1B has the greater steady-state transcript abundance and/or transcript stability of the two. In fact, Tang et al. (2005) reported that more than twice as many FAD2-1B ESTs were found in comparison with FAD2-1A from their database searches, suggesting that the FAB2-1B is likely to be more highly represented than the FAD2-1A isoform in the mRNA pools of developing seed. Our findings do differ from those previously reported by Heppard et al. (1996). They employed northern blot analysis to measure omega-6 desaturase transcript accumulation in seeds at 17 and 26 DAF. They observed that oleic acid increased with increasing temperature but found no corresponding decrease in FAD2-1 transcript accumulation in soybean seeds developing in warm temperatures. They concluded that the increased level of oleic acid and decreased level of linoleic acid in soybean lipids from seeds grown at warm temperatures is likely the result of posttranscriptional regulation of microsomal omega-6 desaturase enzyme activity rather than enhanced expression of FAD2-1 genes. Subsequent research (Tang et al., 2005) has provided evidence for two such posttranscriptional mechanisms. Our data suggests that the temperature-dependent alteration of oleic and linoleic acid in seed storage lipids may be mediated by transcriptional as well as posttranscriptional mechanisms. Real-time RT-PCR may have provided a more sensitive measurement of the effects of temperature on transcript accumulation. Moreover, quantification of the two isoforms of FAD2-1, which we measured separately, may account for much of the discrepancy between our results. Future research focused on quantifying desaturase protein accumulation in seed tissues should be especially enlightening in those situations where enzyme activity and/or content changes, but transcript levels appear not to change.
 |
ACKNOWLEDGMENTS
|
|---|
We thank W. Novitzky (USDA-ARS, North Carolina State University, Raleigh) for the analysis of soybean seed fatty acid composition, and the staff of the Southeastern Plant Environmental Laboratory at North Carolina State University for growth chamber and greenhouse space. Mention of trade names or commercial products in this article is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture.
 |
NOTES
|
|---|
All rights reserved. No part of this periodical may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Permission for printing and for reprinting the material contained herein has been obtained by the publisher.
Received for publication April 4, 2006.
 |
REFERENCES
|
|---|
- American Soybean Association. 2004. SoyStats 2004. Available at www.soystats.com (verified 11 Apr. 2007). American Soybean Association, St. Louis, MO.
- Berberich, T., M. Harada, K. Sugawara, H. Kodama, K. Iba, and T. Kusano. 1998. Two maize genes encoding
-3 fatty acid desaturase and their differential expression to temperature. Plant Mol. Biol. 36:297–306.[CrossRef][Web of Science][Medline] - Brim, C.A. 1966. Registration of Dare soybeans. Crop Sci. 6:95.[Free Full Text]
- Buhr, T., S. Sato, F. Ebrahim, A. Xing, Y. Zhou, M. Mathiesen, B. Schweiger, A. Kinney, P. Staswick, and T. Clemente. 2002. Ribozyme termination of RNA transcripts down-regulate seed fatty acid genes in transgenic soybean. Plant J. 30:155–163.[CrossRef][Web of Science][Medline]
- Burton, J.W., R.F. Wilson, W. Novitzky, G.J. Rebetzke, and V.R. Pantalone. 2005. Registration of N98-4445A, a mid-oleic soybean germplasm line. Crop Sci. 46:1010–1011.[CrossRef][Web of Science]
- Byfield, G.E., H. Xue, and R.G. Upchurch. 2006. Two genes from soybean encoding soluble
9 stearoyl-ACP desaturases. Crop Sci. 46:840–846.[Abstract/Free Full Text] - Cahoon, E.B. 2003. Genetic enhancement of soybean oil for industrial uses: Prospects and challenges. AgBioForum 6:11–13.
- Cheesbrough, T.M. 1989. Changes in enzymes for fatty acid synthesis and desaturation during acclimation of developing soybean seeds to altered growth temperature. Plant Physiol. 90:760–764.[Abstract/Free Full Text]
- Gibson, L.R., and R.E. Mullen. 1996. Soybean seed composition under high day and night growth temperatures. J. Am. Oil Chem. Soc. 73:733–737.[CrossRef][Web of Science]
- Gibson, S., V. Arondel, K. Iba, and C. Somerville. 1994. Cloning of a temperature regulated gene encoding a chloroplast
-3 desaturase from Arabidopsis thaliana. Plant Physiol. 106:1615–1621.[Abstract] - Hammond, E.G., and W.R. Fehr. 1983. Registration of A6 germplasm line of soybean. Crop Sci. 23:192–193.[Free Full Text]
- Heppard, E.P., A.J. Kinney, K.L. Stecca, and G.-H. Miao. 1996. Developmental and growth temperature regulation of two different microsomal
-6 desaturase genes in soybean. Plant Physiol. 110:311–319.[Abstract] - Horiguchi, G., T. Fuse, N. Kawakami, H. Kodama, and K. Iba. 2000. Temperature-dependent translational regulation of the ER omega-3 fatty acid desaturase gene in wheat root tips. Plant J. 24:805–813.[CrossRef][Web of Science][Medline]
- Jones, A., H.M. Davies, and T.A. Voelker. 1995. Palmitoyl-acyl carrier protein (ACP) thioesterases and the evolutionary origin of plant acyl-ACP thioesterases. Plant Cell 7:359–371.[Abstract]
- Kinney, A.J. 1997. Genetic engineering of oilseeds for desired traits. p. 149–166. In J.K. Setlow (ed.) Genetic engineering, principals and methods, Vol. 19. Plenum Press, New York.
- Liu, Q., S.P. Singh, C.L. Brubaker, P.J. Sharp, A.G. Green, and D.R. Marshall. 1997. Isolation and characterization of two different microsomal w-6 desaturase genes in cotton (Gossypium hirsutum L.). p. 383–385. In J.P. Williams, M.U. Khan, and N.W. Lem (ed.) Physiology, biochemistry, and molecular biology of plant lipids. Kluwer Academic Publishers, Dordrecht, the Netherlands.
- MacCarthy, J.J., and P.K. Stumpf. 1980a. The effect of different temperatures on fatty-acid synthesis and polyunsaturation in cell suspension cultures. Planta 147:389–395.[CrossRef][Web of Science]
- MacCarthy, J.J., and P.K. Stumpf. 1980b. Fatty acid composition and biosynthesis in cell suspension cultures of Glycine max L. Merr., Catharanthua roseus G. Don, and Nicotiana tabacum L. Planta 147:384–388.[CrossRef][Web of Science]
- Martinez-Rivas, J.M., P. Sperling, W. Luhs, and E. Heinz. 2001. Spatial and temporal regulation of three different microsomal oleate desaturase genes (FAD2) from normal and high-oleic varieties of sunflower (Helianthus annuus L.). Mol. Breed. 8:159–168.[CrossRef]
- Matsuda, O., H. Sakamoto, T. Hashimoto, and K. Iba. 2005. A temperature-sensitive mechanism that regulates post-transcriptional stability of a plastidial
-3 fatty acid desaturase (FAD8) in Arabidopsis leaf tissues. J. Biol. Chem. 280:3597–3604.[Abstract/Free Full Text] - Miquel, M., D.J. James, Jr., H. Dooner, and J. Browse. 1993. Arabidopsis requires polyunsaturated lipids for low-temperature survival. Proc. Natl. Acad. Sci. USA 90:6208–6212.[Abstract/Free Full Text]
- Moniz de Sa, M., and G. Drouin. 1996. Phylogeny and substitution rates of angiosperm actin genes. Mol. Biol. Evol. 13:1198–1212.[Abstract]
- Murphy, D.J., and P. Piffanelli. 1998. Fatty acid desaturases: Structure, mechanism, and regulation. p. 95–130. In J.L. Harwood (ed.) Plant lipid biosynthesis, fundamentals, and agricultural applications. Society for Experimental Biology Seminar Series 67. Cambridge Univ. Press, Cambridge, UK.
- Neidleman, S.L. 1987. Effects of temperature on lipid unsaturation. Biotechnol. Genet. Eng. Rev. 5:245–268.[Web of Science][Medline]
- Ohlrogge, J., and J. Browse. 1995. Lipid biosynthesis. Plant Cell 7:957–970.[CrossRef][Web of Science][Medline]
- Okuley, J., J. Lightner, K. Feldmann, N. Yadav, E. Lark, and J. Browse. 1994. Arabidopsis FAD2 gene encodes the enzyme that is essential for polyunsaturated lipid synthesis. Plant Cell 6:147–158.[Abstract]
- Rennie, B.D., and J.W. Tanner. 1989. Fatty acid composition of oil from soybean seeds grown at extreme temperatures. J. Am. Oil Chem. Soc. 66:1622–1624.[CrossRef][Web of Science]
- Rubel, G. 1994. Simultaneous determination of oil and water contents in different oilseeds by pulsed nuclear magnetic resonance. J. Am. Oil Chem. Soc. 71:1057–1062.[CrossRef][Web of Science]
- Tang, G.-Q., W.P. Novitzky, H.C. Griffin, S.C. Huber, and R.E. Dewey. 2005. Oleate desaturase enzymes of soybean: Evidence of regulation through differential stability and phosphorylation. Plant J. 44:433–446.[CrossRef][Web of Science][Medline]
- Thomas, J.M.G., K.J. Boote, L.H. Allen, Jr., M. Gallo-Meagher, and J.M. Davis. 2003. Seed physiology and metabolism: Elevated temperature and carbon dioxide effects on soybean seed composition and transcript abundance. Crop Sci. 43:1548–1557.[Abstract/Free Full Text]
- Thompson, G.A., Jr. 1993. Response of lipid metabolism to developmental change and environmental perturbation. p. 591–619. In T.S. Moore Jr. (ed.) Lipid metabolism in plants. CRC Press, Boca Raton, FL.
- Vega, S.E., A.H. del Rio, J.B. Bamberg, and J.P. Palta. 2004. Evidence for the up-regulation of Stearoyl-ACP (
9) desaturase gene expression during cold acclimation. Am. J. Potato Res. 81:125–135. - Wilson, R.F. 2004. Seed composition. p. 621–677. In H.R. Boerma and J.E. Specht (ed.) Soybeans: Improvement, production, and uses. ASA, Madison, WI.
- Wilson, R.F., and J.W. Burton. 1993. Effects of growth temperature on expression of a high- stearic acid trait in soybean. p. 422–420. In T.H. Applewhite (ed.) Proc. World Conf. Oilseed Technology and Utilization. Am. Oil Chemists' Soc., Champaign, IL.
- Wolf, R.B., J.F. Cavins, R. Kleiman, and L.T. Black. 1982. Effects of temperature on soybean seed constituents: Oil, protein, moisture, fatty acids, amino acids, and sugars. J. Am. Oil Chem. Soc. 59:230–232.[CrossRef][Web of Science]
This article has been cited by other articles:

|
 |

|
 |
 
P. Zhang, J. W. Burton, R. G. Upchurch, E. Whittle, J. Shanklin, and R. E. Dewey
Mutations in a {Delta}9-Stearoyl-ACP-Desaturase Gene Are Associated with Enhanced Stearic Acid Levels in Soybean Seeds
Crop Sci.,
November 24, 2008;
48(6):
2305 - 2313.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. E. Byfield and R. G. Upchurch
Effect of Temperature on Microsomal Omega-3 Linoleate Desaturase Gene Expression and Linolenic Acid Content in Developing Soybean Seeds
Crop Sci.,
November 7, 2007;
47(6):
2445 - 2452.
[Abstract]
[Full Text]
[PDF]
|
 |
|