| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
a Dep. of Forest Mycology and Pathology, Swedish Univ. of Agricultural Sciences (SLU), Box 7026, S 750 07 Uppsala, Sweden
b International Maize and Wheat Improvement Center (CIMMYT), Apdo. Postal 6-641, 06600 México, D.F., México
c Campo Experimental Valle de México INIFAP, Apdo. Postal 10, 56230, Chapingo, Edo de México, México
d CSIRO, Plant Industry, GPO Box 1600, Canberra ACT 2601, Australia
* Corresponding author (sybil.herrera{at}mykopat.slu.se).
 |
ABSTRACT |
|---|
 TOPNOTES ABSTRACT INTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Abbreviations: AFLP, amplified fragment length polymorphism • PCR, polymerase chain reaction • RAPD, random amplified polymorphic DNA • RFLP, restriction fragment length polymorphism • SSR, simple sequence repeats • STS, sequence tagged site
|
INTRODUCTION |
|---|
|
TOPNOTESABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
P. triticina races virulent on durum wheat are different from those affecting common wheat (Huerta-Espino and Roelfs, 1989; Singh, 1991; Ordonez et al., 2004; Goyeau et al., 2006), and the genes that confer resistance against these races are therefore expected to be different. Ordonez et al. (2004) found that durum leaf rust races in Mexico, the U.S. (California), France, Spain, and Argentina, were similar in their avirulence/virulence pattern based on the common wheat (T. aestivum) differential sets for leaf rust used in North America (Long and Kolmer, 1989; Singh 1991). The similarity of the predominant Mexican durum wheat leaf rust race to those present in Spain (Martinez et al., 2005) and France (Goyeau et al., 2006) has also been confirmed. Durum wheat germplasm with resistance to race BBG/BN would therefore be useful in a wide range of production areas.
Despite the increasing problem of susceptibility of durum wheat to leaf rust, little is known on the occurrence or nature of resistance genes in durum wheat. Of the over 50 known designated leaf rust resistance genes, only Lr14a and Lr23 originated from durum or emmer wheat and were characterized after their transference into common wheat (McIntosh et al., 1995). Marais et al. (2005) recently transferred another leaf rust resistance gene, designated as Lr53, from wild emmer (T. turgidum ssp. dicoccoides) to common wheat. The gene was located on chromosome 6BS using cytogenetic tools and then mapped using a chromosome 6S restriction fragment length polymorphism (RFLP) marker Xpsr167 (Marais et al., 2005). In contrast to hexaploid wheat, use of cytogenetic tools to map leaf rust resistance genes in durum wheat was limited to two studies where either the ‘Langdon’ durum D-genome disomic substitution lines (Hussein et al., 2005) or trisomics (Bhagwat et al., 2004) were used.
Molecular mapping has emerged as a powerful technique to characterize and establish chromosomal locations of genes that determine simply or quantitatively inherited traits (Gupta et al., 1999). Several leaf rust resistance genes in common wheat were mapped using these techniques (Nelson et al., 1997; Brown-Guedira et al., 2003; William et al., 2003). Zhang et al. (2005) transferred into tetraploid wheat and molecularly characterized Lr19 originating from Lophopyrum ponticum (Agropyron elongatum). This gene is effective against leaf rust races of durum wheat present in the USA (California) and in Mexico. Molecular tools can also aid in pyramiding effective leaf rust resistance genes present in durum wheat to prolong their lifespan.
Herrera-Foessel et al. (2005) studied the genetic basis of resistance in the durum wheat lines ‘Camayo’ and ‘Storlom’ which are resistant to the Mexican durum wheat P. triticina race BBG/BN. Under high leaf rust pressure in Mexico, Storlom was immune (0%) in field trials, while Camayo displayed up to 15% leaf rust severity according to the modified Cobb Scale (Peterson et al., 1948) with a moderately resistant to resistant host response to infection. The populations used by Herrera-Foessel et al. (2005) were generated by crossing Storlom and Camayo with a susceptible durum wheat ‘Atil C2000’ as well as by intercrossing the two resistant parents. Genetic studies conducted in the F1, F2, and F3 generations indicated that both resistant parents carried a partially dominant leaf rust resistance gene and allelic tests in the F2 generation indicated that the two resistance genes were linked in repulsion, because no completely susceptible plants were observed. These two genes provide protection against P. triticina race BBG/BN predominant in Northwestern Mexico as well as in other countries where durum wheat leaf rust races are similar.
The objective of our study was to determine the chromosomal location of the two leaf rust resistance genes identified by Herrera-Foessel et al. (2005) in the durum wheat lines Camayo and Storlom using molecular markers.
|
MATERIALS AND METHODS |
|---|
|
TOPNOTESABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Lr3 is a known leaf rust resistance locus on the long arm of chromosome 6B with three reported alleles; Lr3a, Lr3bg, and Lr3ka (Haggag and Dyck, 1973; McIntosh et al., 1995). The ‘Thatcher’ near-isogenic common wheat lines RL6002, RL6007, and RL6042, which are known to carry Lr3a, Lr3ka, and Lr3bg, respectively (Roelfs et al., 1992), and Thatcher (control), were included in greenhouse rust evaluations and molecular characterization for detecting if any of these alleles could be present in either Camayo or Storlom.
Greenhouse and Field Studies
The 197 F3 families from the Storlom x Camayo cross were evaluated for leaf rust response in both field and greenhouse with P. triticina race BBG/BN. Approximately 60 plants per family were sown in the field in 0.8-m long paired rows on 80-cm wide raised beds. An artificial rust epidemic was initiated by inoculating spreader rows of the susceptible cultivar Atil C2000 sown as hills in the middle of a 0.4 m path on one side of the plot. Leaf rust reactions of F3 lines were recorded when Atil C2000 displayed about 100% leaf rust severity based on the modified Cobb Scale (Peterson et al., 1948). Each F3 family was evaluated for rust reaction and grouped into one of the following categories: (i) homozygous resistant for the Camayo response (immune), (ii) homozygous resistant for the Storlom response (about 15% rust severity and moderately resistant host reaction), (iii) segregating for the response of the two parents, and (iv) recombinants. The only recombinants that we could possibly identify phenotypically were homozygous susceptible families or families that segregated for susceptible plants.
Approximately 25 seeds of each of Storlom x Camayo F3 families were evaluated as seedlings in the greenhouse. Atil C2000, Camayo, Storlom and the F1 hybrids from the crosses Atil C2000 x Storlom, Atil C2000 x Camayo, and Storlom x Camayo were also included. Ten d old seedlings at the 2-leaf stage were inoculated by spraying urediniospores of P. triticina race BBG/BN suspended in non-phytotoxic mineral oil (Soltrol 170, Phillips 66 Co., Bartlesville, OK). Plants were then placed in a dew-chamber overnight before transferring them to the greenhouse at 18 to 25°C. Infection-type responses were recorded 10 d after inoculation using the 0 to 4 scale described in Roelfs et al. (1992). In this scale, infection-types ‘3’ and ‘4’ are categorized as a susceptible response and the remaining infection-types are considered as resistant.
Camayo, Storlom, near-isogenic Thatcher lines carrying Lr3a, Lr3ka, and Lr3bg, and the susceptible durum and common wheat checks, Atil C2000 and Thatcher, respectively, were compared for their seedling and adult plant rust reactions under three temperatures in the greenhouse. Seedlings (2-leaf stage) and adult plants (flag leaf stage) were inoculated with P. triticina race BBG/BN following the same procedure as described earlier. After overnight incubation in a dew chamber at 18 to 20°C, plants were transferred to three greenhouses maintained at low, intermediate, and high temperature regimes, respectively (Table 1). Approximately 20 seedlings and eight adult plants per accession were evaluated at each temperature. Infection-type responses according to Roelfs et al. (1992) were recorded for the second leaves (seedling stage) and flag leaves (adult plants) 11 and 13 d, respectively after inoculations.
|
For the bulked segregant analysis (Michelmore et al., 1991), DNA from each of 14 homozygous resistant and 14 homozygous susceptible F3 families from Atil C2000 x Camayo and Atil C2000 x Storlom crosses were separately pooled to obtain one susceptible bulk and one resistant bulk for each population.
The amplified fragment length polymorphism (AFLP) technique was used according to Vos et al. (1995) but with some modifications (Hoisington et al., 1994; William et al., 2003). A pre-amplification step was performed using PstI/MseI restriction enzyme sites and a single selective nucleotide at the 3'-end of both the PstI and MseI primers. The core and enzyme sequences (5'- 3') of the primers used for the pre-amplification step were (MseI) GAT GAG TCC TGA GTA A and (PstI) GAC TGC GTA GGT GCA G. The single selective nucleotides for the pre-amplification step were either C and A, or G and T, for MseI and PstI, respectively. In the main amplification step three selective nucleotides were used for each of the MseI and PstI primers. In total, ninety-six different AFLP primer enzyme combinations were applied to the resistant and susceptible bulks and their respective parents (Atil C2000, Camayo, and Storlom).
The AFLP bands were designated according to the nomenclature in KeyGene, http://wheat.pw.usda.gov/ggpages/keygeneAFLPs.html (verified 15 May 2007), e.g., band P33/M48352 indicates PstI and MseI primers 33 and 48, respectively and subscript is the estimated size in base pairs. The first set of 48 primer combinations for the main amplification step involved four PstI+NNN primers, sequence is in brackets, (P33[AAG], P36 [ACC], P37[ACG], P41[AGG]) with 12 MseI+NNN primers (M47[CAA], M48[CAC], M49[CAG], M50[CAT], M55[CGA], M56[CGC], M57[CGG], M58[CGT], M59[CTA], M60[CTC], M61[CTG], M62[CTT]) and the second set of 48 primer combinations consisted of four different PstI+NNN primers (P81[TAG], P87[TGA], P88[TGC], P89[TGG]) with 12 additional PstI+NNN primers (M63[GAA], M64[GAC], M65[GAG], M66[GAT], M67[GCA], M68[GCC], M69[GCG], M70[GCT], M75[GTA], M76[GTC], M77[GTG], M78[GTT]).
The PstI selective amplification primers were end-labeled with digoxigenin (Sigma–Genosys Ltd., UK). Bands were detected using a chemiluminescent system, which included the transference of the amplification product to a nylon membrane, washing the membrane with anti-dig/alkaline phosphatase and CSPD, and developing X-ray films (Hoisington et al., 1994). The size of the marker was estimated by comparing the position of the AFLP bands with a dig-labeled size marker. When polymorphisms were identified between the bulks and the parents, individual families that made the bulks (14 homozygous resistant and 14 homozygous susceptible) were screened with the same AFLP primer combinations. If linkage was found between the AFLP marker and the resistance gene, the entire F3 population from each respective cross, including the segregating families that originated from heterozygous F2 plants, was used for establishing the linkage between the AFLP marker and the resistance gene.
Partial Linkage Analysis
The AFLP primers that produced polymorphic bands and that were linked to resistance genes either in Camayo or Storlom were screened for polymorphisms in six sets of common wheat (T. aestivum) parents; ‘Opata M85’, ‘Synthetic W-7984’ (‘Altar C84’/Aegilops squarrosa) (Roeder et al., 1998), ‘Oligoculm’, ‘Fukuho-komugi’ (Suenaga et al., 2005), ‘Frontana’ and ‘Inia 66’ (unpublished CIMMYT data). These common wheat parents have been used in developing either recombinant inbred lines or double haploids for the genotyping and construction of linkage maps with RFLP, RAPD and SSR markers. The marker data for the genetic map of the population Opata M85 x Synthetic W-7984 (also referred to as the international Triticeae mapping initiative, ITMI, population) is publicly available in GrainGenes (http://wheat.pw.usda.gov/GG2/index.shtml; verified 15 May 2007).
Whenever the identified AFLP bands were polymorphic in any of the common wheat parents, segregation of the same band was investigated in available progenies of the respective common wheat mapping population. The number of lines evaluated varied from 96 to 114 depending on the population. The segregation pattern of the AFLP band in the common wheat populations was used for the linkage analysis in MAPMAKER Version 3.0 at minimum 3.0 log of odds (LOD) score (Lander et al., 1987).
SSR and STS Markers
Thirty-three SSR markers, chosen for even distribution on chromosome 6B according to Somers et al. (2004) and sequence-tagged site (STS) primer Xmwg798 (Kunzel et al., 2000), were also used for screening Camayo and Storlom and their respective bulks. The PCR reactions were performed according to Hoisington et al. (1994). The PCR program used depended on the optimal annealing temperature for each primer. The PCR products were separated on either 3% agarose gels with 2 parts SeaKem: 3 parts MetaPhor agarose or 8% acrylamide (29:1) gels depending on the polymorphisms observed. Bands were visualized in agarose gels with ethidium bromide and with silver staining for acrylamide gels (Hoisington et al., 1994).
The Lr3 locus is positioned on the long arm of chromosome 6B (McIntosh et al., 1995). Sacco et al. (1998) identified an RFLP marker Xmwg798 that co-segregated with the allele Lr3a in the common wheat ‘Sinvalocho MA’. This RFLP marker has been converted to a PCR-based STS marker (Kunzel et al., 2000). The forward and reverse primer sequences (5'- 3') of Xmwg798 are GGCTGTCTACATCTTCTGCA and CAAGTGTTGAGAAGGAGAGT, respectively, and the size of the fragment is 365 bp (http://wheat.pw.usda.gov/GG2/index.shtml). We tested the STS marker Xmwg798 in Atil C2000, Camayo, Storlom, and in the F3 populations of Atil C2000 x Storlom and Camayo x Storlom crosses.
Statistical Analysis
The chi-squared analysis (
2) was conducted for testing the hypothesis that the observed segregation ratio of markers in the populations did not deviate significantly from expected ratio at the 5% probability level. The same test was also used for comparing the phenotypic responses of F3 families in the Camayo x Storlom cross (Table 2).
|
|
RESULTS |
|---|
|
TOPNOTESABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
2-test as expected in a recombinant inbred population.
|
|
Identification of the Resistance Gene in Storlom
The STS version of the marker Xmwg798, reported to co-segregate with Lr3a in the common wheat cultivar Sinvalocho MA (Sacco et al., 1998), was present in Storlom but absent in Camayo and the susceptible parent Atil C2000. Co-segregation of dominant marker Xmwg798 with resistance in the Atil C2000 x Storlom population of 92 F3 families indicated that the resistance gene present in Storlom could be Lr3a. The segregation of Xmwg798 in the F3 population conformed to the expected 3:1 ratio.
Linkage of Resistance Genes in Camayo and Storlom
In the field evaluation of the F3 population from the Camayo x Storlom cross, the families either displayed resistance responses similar to one of the parents or a combination of both (data not shown). No homozygous susceptible family or a family segregating for susceptible plants was found. The absence of susceptible plants (recombinants) among more than 5000 plants evaluated in the 115 F3 families, derived from heterozygous F2 plants, indicates that the resistance genes in the two parents are most likely allelic or very closely linked.
The leaf rust infection-type responses of F3 families in the greenhouse were either homozygous ‘0;’ and ‘;1’ or segregating for ‘0;’ and ‘;1’ (Table 2). A few families had plants with higher responses than either of the parents (‘X+’), but no completely susceptible recombinant plant was observed. In the same greenhouse test the infection-type responses of Camayo and Storlom were ‘;1’ and ‘0;’, respectively. The responses of F1 plants from the Atil C2000 x Storlom and Atil C2000 x Camayo crosses were ‘;1-’ and ‘X’, respectively, whereas the F1 plants of the Camayo x Storlom cross displayed infection-type ‘0;’.
Screening for the three AFLP markers, P33/M48352, P81/M66165, and P87/M70128, and the STS marker Xmwg798 was done on the 181 F3 families of the Camayo x Storlom population to establish the linkage between the genes present in the two parents. The AFLP markers acted in repulsion with respect to the STS marker. The Xmwg798 marker showed co-segregation with the resistance in Storlom and was always absent in the families displaying responses of Camayo. The genetic distance between the AFLP markers linked to the resistance gene in Camayo and the resistance gene in Storlom was 1.2, 5.0, and 8.1 cM for P33/M48352, P87/M70128 and P81/M66165, respectively (Fig. 3
). All the markers showed a good fit to the expected 3:1 ratio based on the 2–test in the entire F3 population of the Camayo x Storlom cross.
|
|
|
DISCUSSION |
|---|
|
TOPNOTESABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Three AFLP markers were identified to be linked with leaf rust resistance genes in Camayo, with the nearest marker located at a distance of 2.3 cM to P33/M48352 (Fig. 2). The linkage between the gene in Storlom and the gene in Camayo was studied in the Camayo x Storlom F3 population in the greenhouse and field, and by screening with the three AFLP markers and the STS marker in the Camayo x Storlom F3 population. The absence of susceptible families, or families segregating with susceptible plants, in the field and greenhouse screenings, indicated the lack of recombination between the resistance genes identified in Camayo and Storlom. The three AFLP markers showed close association with the STS marker Xmwg798 with recombination distances ranging between 1.2 and 8.1 cM (Fig. 3). This indicates that the gene in Camayo is either a different allele at the Lr3 locus or, more probably, very closely linked.
Herrera-Foessel et al. (2005) estimated a recombination frequency of 20% between the leaf rust resistance genes identified in Camayo and Storlom. This estimate was based on leaf rust evaluations of the F2 population of the Camayo x Storlom cross. In the study presented here, further investigation using F2–derived F3 families and molecular markers led to a much closer distance between the two genes in Camayo and Storlom. The gene/allele in Camayo seems to be temperature-sensitive (Table 1) and the background genotype could also have an important influence. These factors could explain why some F2 plants had higher responses than the F1 plants from the same cross (Herrera-Foessel et al., 2005) and why few plants in the F3 in our study had higher infection-type responses (up to ‘X+’ according to the 0–4 infection-type scale).
In our study, all tested SSR markers located in chromosome 6B according to Somers et al. (2004) failed in establishing linkage with any of the two genes in Storlom or Camayo. The Lr3 locus is positioned in an area with low density of available SSR markers. None of the SSR markers tested was positioned within the linkage group that was generated in the ITMI genetic map when analyzing the AFLP marker P87/M70128 (Fig. 1). Similar results were found by Khan et al. (2005) who failed to show any association to Lr3a present in the common wheat ‘Yarralinka’ when testing eight SSR markers specific to chromosome 6B, but instead identified an inter-simple sequence repeat (ISSR) marker, UBC840540, at a distance of 6.0 cM.
Although Singh et al. (1992) postulated the presence of Lr3a together with an unknown gene in one of the fifty durum wheat lines maintained at Punjab Agricultural University, India, our study represents the first molecular confirmation of this gene in durum wheat. Storlom and Camayo are resistant to all Mexican races of P. triticina (data not presented) and they most likely carry the unidentified resistance gene present in Altar C84 and Atil C2000 that became ineffective with race BBG/BN (Singh et al., 2004). We therefore could not determine the race-specificity of the resistance genes present in Storlom and Camayo with other Lr3a, Lr3ka, and Lr3bg avirulent or virulent races.
The RFLP marker Xmwg798 was previously mapped in a durum wheat population. Du and Hart (1998) used the T. turgidum ssp. durum Langdon- T. turgidum ssp. dicoccoides chromosome 6A and 6B recombinant substitution lines, and a F2 population derived from a Langdon- T. turgidum ssp. dicoccoides disomic chromosome 6A substitution line x Langdon cross to construct extended 6A and 6B linkage maps. The RFLP marker Xmwg798 was mapped in the long arm of both chromosomes. Even if this marker has been mapped in two different chromosomes, in the durum wheat populations used in our study (F3 Atil C2000 x Storlom, F3 Camayo x Storlom) and in the three Lr3 near-isogenic common wheat lines, the STS marker Xmwg798 was useful in detecting the Lr3 locus present only on chromosome 6BL.
The three known alleles at the Lr3 locus are differentiated by their different responses to a collection of common wheat P. triticina races. Lr3a, commonly referred to as Lr3, is known to be present in ‘Democrat’, ‘Mediterranean’, as well as in other common wheats such as Sinvalocho MA (Haggag and Dyck, 1973; McIntosh et al., 1995). Allele Lr3bg was originally identified in the common wheat ‘Bage’, and Lr3ka in the common wheat ‘Klein Aniversario’ (Haggag and Dyck, 1973; McIntosh et al., 1995). We determined the presence of the STS marker Xmwg798 in the three near-isogenic common wheat lines—Lr3a, Lr3bg, and Lr3ka—and its absence in the Thatcher control, indicating that this marker is locus-specific rather than allele-specific. The three known Lr3 alleles therefore cannot be differentiated using Xmwg798. Based on our results it cannot therefore be concluded that the gene in Storlom is Lr3a or Lr3bg. The presence of Lr3ka in Storlom is doubtful because the seedling and adult plant infection-type response of the near-isogenic common wheat line carrying Lr3ka is very different from the response of Storlom (Table 1).
The Lr3 allele present in Storlom could have been transferred from hexaploid wheat, as Storlom is a backcross derivative from a cross between the common wheat line Sitella and the durum wheat line Musk. Musk is a cross between Altar C84 (susceptible) and the common wheat ‘Alondra’.
The resistance allele in Camayo is most likely derived from an Ethiopian landrace which is one of the parents. The second parent, Altar C84, is susceptible to the Puccinia triticina race BBG/BN (Singh et al., 2004; Herrera-Foessel et al., 2005). With race BBG/BN, Camayo had higher seedling and adult plant infection-type responses than those displayed by the near-isogenic common wheat lines carrying any of the three known alleles at Lr3 locus (Table 1). The resistance in Camayo was better expressed, i.e., infection-type was lower, at reduced temperatures, which was not the case for any of the three Lr3 alleles in our studies. In other studies (Dyck and Johnson, 1983), the resistance of the three known Lr3 alleles was less expressed, i.e., infection-types were higher at low temperatures when P. triticina isolates from common wheat that give intermediate infection-type responses, were used. Camayo did not have the Lr3 locus-specific STS marker Xmwg798, which was present in Storlom and in Thatcher near-isogenic tester lines for the three known Lr3 alleles. We therefore suggest that the resistance in Camayo must be conferred by a different gene located near the Lr3 locus rather than by another allele at the same locus.
Only a few of the more than 50 leaf rust resistance genes that have been designated in common wheat are known to have originated from durum wheat, and not many leaf rust resistance genes in durum wheat have been identified. The potential value of deploying Lr3a/Lr3bg in common wheat is considered low, since virulence in common wheat leaf rust races to these alleles is frequent (McIntosh et al., 1995). The deployment of Lr3a/Lr3bg in common wheat resulted in a rapid buildup of virulence in common wheat specific races. The durum wheat leaf rust race, BBG/BN, is however avirulent to most of the known designated leaf rust resistance genes previously identified in common wheat, including the three Lr3 alleles. The potential value of many of these known common wheat genes could therefore be considered high when used in durum wheat in Mexico and in other countries with similar durum wheat leaf rust populations. To enhance the longevity of these genes in durum wheat they should be deployed in combination with other effective leaf rust resistance genes.
|
ACKNOWLEDGMENTS |
|---|
|
NOTES |
|---|
|
TOPNOTESABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
Received for publication October 17, 2006.
|
REFERENCES |
|---|
|
TOPNOTESABSTRACTINTRODUCTIONMATERIALS AND METHODSRESULTSDISCUSSIONREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  S. A. Herrera-Foessel, R. P. Singh, J. Huerta-Espino, J. Crossa, A. Djurle, and J. Yuen Genetic Analysis of Slow-Rusting Resistance to Leaf Rust in Durum Wheat Crop Sci., November 24, 2008; 48(6): 2132 - 2140. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| The SCI Journals | Agronomy Journal | Vadose Zone Journal | |||
| Journal of Natural Resources and Life Sciences Education |
Soil Science Society of America Journal | ||||
| Journal of Plant Registrations | Journal of Environmental Quality |
The Plant Genome | |||
