Crop Science Illumina
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published online 24 February 2006
Published in Crop Sci 46:840-846 (2006)
© 2006 Crop Science Society of America
677 S. Segoe Rd., Madison, WI 53711 USA
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Byfield, G. E.
Right arrow Articles by Upchurch, R. G.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Byfield, G. E.
Right arrow Articles by Upchurch, R. G.
Agricola
Right arrow Articles by Byfield, G. E.
Right arrow Articles by Upchurch, R. G.
Related Collections
Right arrow Soybean
Right arrow Seed Physiology
Right arrow Crop Genetics

GENOMICS, MOLECULAR GENETICS & BIOTECHNOLOGY

Two Genes from Soybean Encoding Soluble {Delta}9 Stearoyl-ACP Desaturases

G. E. Byfielda, H. Xueb and R. G. Upchurchc,*

a Microbiology Dep., North Carolina State Univ., Raleigh, NC 27695
b Crop Science Dep., North Carolina State Univ., Raleigh, NC 27695
c USDA-ARS Soybean and Nitrogen Fixation Unit and Plant Pathology Dep., North Carolina State Univ., Raleigh, NC 27695

* Corresponding author (greg_upchurch{at}ncsu.edu)


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The {Delta}9 stearoyl acyl-carrier protein desaturase (SACPD) gene of soybean [Glycine max (L.) Merrill] encodes a soluble enzyme that converts stearic to oleic acid. Understanding the regulation of SACPD expression and enzyme activity are thus important steps toward developing soybean lines with altered stearic or oleic acid content. Using primers designed to a G. max SACPD cDNA sequence, a 3648-bp product was cloned and sequenced from the genome of cultivar Dare. Comparison of the third SACPD exon protein sequence with other available Glycine SACPD sequences revealed unique amino acid variability at positions 310 and 313. Sequence-specific primers were designed for Real-time RT-PCR (reverse transcriptase-polymerase chain reaction) for this region of exon 3. Diagnostic and specific products were recovered with these primers using Dare cDNA template and Dare genomic DNA. Sequencing of a second genomic clone from Dare confirmed that there were two SACPD genes, designated A and B, in this cultivar. Survey of the genomes of 51 soybean lines and cultivars with PCR and the gene-specific primers indicated that all 51 had both A and B. Differences between SACPD-A and -B transcript abundance in soybean tissues, while quantifiable, were not dramatic. SACPD-A and -B transcript accumulation for three seed developmental stages between R5 and R6 was essentially equal. Biochemical analysis of the proteins encoded by these two SACPD genes may reveal whether the amino acid variability uncovered in this study has any relation to enzyme activity.

Abbreviations: EST, expressed sequence tag • FAD, fatty acid desaturase • RT-PCR, reverse transcription-polymerase chain reaction • SACPD, stearoyl acyl carrier protein desaturase


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
SOYBEAN OIL is a mixture of five fatty acids (palmitic, stearic, oleic, linoleic, and linolenic) that differ greatly in melting points, oxidative stabilities, and chemical functionalities (Cahoon, 2003). Although seed fatty acid composition is controlled by quantitative genetic traits, current research also includes a strong focus on the contribution and manipulation of fatty acid desaturase genes. The goal of efficiently altering fatty acid composition to meet the specific needs of industry therefore requires the efforts of soybean breeders and molecular geneticists.

Increasing the stearic acid content of soybean oil is desirable for certain food-processing applications since increased stearic acid content offers the potential for the production of solid fat products without hydrogenation (Spencer et al., 2003). This would reduce the content of transfat in food products and reduce a current health concern. High stearic acid oil could also be used as a replacement for tropical oils that are also high in palmitic acid, which poses a heart disease risk.

Stearic acid concentration in soybean is genetically determined by alterations at the Fas locus. In addition to FAM94–41 (Pantalone et al., 2002), a high stearic acid line carrying a natural mutation (fasnc), five other soybean germplasm lines have been reported to carry mutated stearic acid alleles that increase stearic acid: A6, fasa (Hammond and Fehr, 1983); FA41545, fasb (Graef et al., 1985a); A81–606085, fas (Graef et al., 1985b); KK-2, st1 (Rahman et al., 1997); and M25, st2 (Rahman et al., 1997). Fasa (30% stearic acid), fasb (15% stearic acid), and fas (19% stearic acid) are allelic and represent different mutations in the same gene (Burton et al., 2004; Spencer et al., 2003). One candidate gene, although unproven, for the Fas locus in soybean, is the {Delta}9 stearoyl-acyl carrier protein (ACP) desaturase (Wilson, 2004). The {Delta}9 stearoyl-ACP desaturase enzyme (SACPD), through the insertion of a double bond at C9, converts stearic to oleic acid. Thus, SACPD occupies a key position in C18 fatty acid biosynthesis since perturbation of SACPD gene expression and/or enzyme activity may modulate the relative level of both stearic and oleic acid in soybean oil. Down-regulated SACPD expression or enzyme activity could produce oil with greater stearic acid, while increased expression of SACPD or enzyme activity could produce oil with greater oleic acid content.

In this study, we determined that there are two SACPD genes in soybean, a situation not previously recognized. The objective of this research was to characterize SACPD gene structure, determine the distribution of the SACPD genes in Glycine, and analyze SACPD expression levels in stages of seed development.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Amplification, Cloning, and Sequencing
Genomic DNA was prepared form liquid nitrogen-frozen, powdered soybean leaves with the DNeasy Plant Mini kit from Qiagen (Valencia, CA) following manufacturer's protocol. Soybean leaves were harvested from 5-wk-old greenhouse grown plants. DNA samples were resuspended in sterile water. Soybean genomic SACPDs were amplified with oligonucleotide primers 5'GCGCCTTACATCACATAC 3'-forward and 5'GCTGCCCCTAACTGC 3'-reverse that were based on the GenBank mRNA sequence (accession number L34346) for a Glycine max, soluble stearoyl-acyl carrier protein desaturase (SACPD). In other experiments, SACPD exons 2 and exons 3 were amplified. Primers for exon 2 amplification were 5'CATCCTTACCCTATACCTG3'-forward and 5'CTACCATTGCGGAAGACC3'-reverse. Primers for exon 3 were 5'GATTCTTCATAGCTGCTGC3'-forward and 5'GCTGCCCCTAACTGC3'-reverse. Amplification reactions (25 µL) contained 50 ng genomic DNA, 250 nM each primer, 2.5 µM each dNTP, 1 unit Taq DNA polymerase (Fisher, Atlanta, GA), and 1x PCR buffer [300 mM Tris-HCL, 75 mM (NH4)2SO4, 7.5 mM MgCl2, pH 8.5]. Reaction conditions were 94°C for 2 min (1 cycle), then 94°C for 1 min, 55°C for 2 min, 72°C for 3 min (30 cycles), then 72°C for 7 min.

Primers were also designed to a region of variability in exon 3 of SACPD. PCR with these primers produced products that discriminated between SACPD gene A (133 bp) and gene B (111 bp). These gene-specific primers were used to type soybean cultivars as well as to quantify steady state mRNA accumulation by real-time RT-PCR. Gene-specific primers for SACPD-A (primer set A) were 5'CCTGTTTGATAACTACTCTGCC3'-forward and 5'TCTTCCCTCACCTGAAAGTCCG3'-reverse. Gene-specific primers for SACPD-B (primer set B) were 5'CCTGTTTGATAGCTACTCTTCG3'-forward and 5'GTTAGCTGCTCCACCTCC3'-reverse. Primers for the soybean housekeeping gene actin were 5'GAGCTATGAATTGCCTGATGG3' forward and 5'CGTTTCATGAATTCCAGTAGC3' reverse derived from GenBank accession number U60500 (Moniz de Sa and Drouin 1996). Amplification of actin was done according to the protocol outlined above for SACPD. Amplification reactions (25 µL) for PCR with SACPD gene-specific primers contained 50 ng of EcoRI restricted genomic DNA, 2 µM each primer, 250 µM dNTPs, 1 unit Taq DNA polymerase (Fisher, Atlanta, GA), and 1x PCR buffer [300 mM Tris-HCl, 75 mM (NH4)2SO4, 7.5 mM MgCl2, pH 8.5]. Reaction conditions were 94°C for 2 min (1 cycle), then 94°C for 1 min, 66.8°C for 2 min, 72°C for 3 min (40 cycles), then 72°C for 7 min.

PCR amplification reactions were performed in a MJ Research PTC-100 thermocycler (Watertown, MA). PCR products were analyzed on ethidium bromide stained, 1% (w/v) agarose gels after electrophoresis with a 100-bp DNA ladder molecular weight markers (Invitrogen, Carlsbad, CA). Amplicons were cloned into the sequencing vector pCR 2.1 with the TOPO TA cloning kit supplied by Invitrogen (Carlsbad, CA). Both strands of each PCR clone were sequenced at the Iowa State University Biotechnology Center, Ames, IA. Contigs were assembled by Vector NTI Advance 9.1 (Invitrogen). Assignment of open reading frames, translation to amino acid sequences, and sequence comparisons were done with the NCBI tools for data mining (Gish and States, 1993; Altschul et al., 1990) and with Chromas (http://www.technelysium.com.au/; verified 18 November 2005). Sequences were aligned by Blossum62 Divide-and-Conquer Multiple Sequence Alignment v. 1.0 (BiBiServ, Bielefeld University Bioinformatics Server). Assignment of SACPD exons and introns was done by MacVector v. 7(IBI, New Haven, CT) and NetGene2 WWW Server (Center for Biological Sequence Analysis, The Technical University of Denmark).

Genomic DNA Gel Blot Analysis
Genomic DNA (6 µg) was digested with restriction enzymes, electrophoresed through a 0.8% (w/v) agarose gel, and transferred to Nytran Plus (Schleicher & Schuell, Keene, NH) membranes. The membranes were probed with [{alpha}-32P] dCTP-labeled DNA fragments that correspond to an exon 3 region for either SACPD-A or SACPD-B and exposed to X-ray film. Membrane hybridization and washing procedures were those described for Ultrahyb solution (Ambion, Austin, TX).

RNA Isolation and Processing
Glycine max Dare plants were grown under greenhouse conditions and plant tissues (pod, leaf, lateral root) harvested at 18 and 35 d after flowering (DAF). Dare plants were also grown under controlled day/night temperatures of 26/22°C and seeds were harvested at four stages (18, 23, 28, and 35 DAF) of development between R5 and R6. Tissues and seeds were quickly frozen in liquid nitrogen and stored at –80°C until RNA was extracted. Samples were pooled from three plants, and RNA was isolated from 100 mg of frozen powdered tissue with the Qiagen RNeasy Plant Mini kit (Valencia, CA) following the manufacturer's protocol. The RNA extraction was repeated on two other pooled samples. RNA samples were DNase treated with Ambion DNA-free (Austin, TX) according to the manufacturer's protocol. RNA concentrations were determined spectrophotometrically with absorbance at 260 nm. Samples were diluted to 50 ng/µL in sterile water and aliquots stored at –80°C until use. To verify RNA integrity, 500 ng of total RNA of each sample was examined on a 1% (w/v) agarose gel after electrophoresis and staining with ethidium bromide.

Real-Time Reverse Transcriptase PCR
Real-time reverse transcriptase PCR (Winer et al., 1998; Bustin, 2002) was performed with the iCycler iQ (Bio-Rad, Hercules, CA) using the QuantiTech SYBR Green RT-PCR kit (Qiagen, Valencia, CA). Each reaction contained 12.5 µL of 2x SYBR Green PCR master mix, 250 nM forward and reverse gene-specific primers for SACPD gene A or gene B, 0.25 µL MgCl2 (25 mM), 0.25 µL RT mix, 250 ng RNA, and nuclease-free water to a final volume of 25 µL. The reactions were performed in a 96-well plates (0.2-mL tube volume) sealed with optical tape. Reverse transcription was performed at 50°C for 30 min followed by 95°C for 15 min to inactivate the reverse transcriptases and to activate the HotStar Taq DNA polymerase. PCR amplification involved 45 cycles of 15 s at 94°C, 30 s at 60°C, and 30 s at 72°C followed by melt curve analysis over a 10°C temperature gradient at 0.05°C s–1 from 78 to 88°C. Duplicate reactions were done for each sample. Steady state transcript levels for SACPD genes were mathematically determined by comparison of individual cycle threshold (Ct) values with a standard curve generated from serial dilutions of a PCR standard (Peirson et al., 2003) from soybean genomic DNA. PCR efficiency ranged from 93 to 98%, and negative control reactions did not produce any products. Targets (copy number), initially determined per microgram of total RNA isolated, were normalized as a percentage of soybean actin gene expression level.

Determination of Seed Fatty Acid Composition
Fatty acid methyl esters (FAME) of mature soybean seed samples were prepared by acid methanolysis. Seed tissue, ground to a powder, was heated at 85°C for 90 min in a (v/v) 5% HCl–95% methanol solution. FAME was partitioned 2x into hexane and transferred to 2-mL vials for analysis. The FAMEs were separated by gas chromatography with an HP 6890 GC (Agilent Technologies, Inc., Wilmington, DE) equipped with a DB-23 30-m x 0.53-mm column (same source). Operating conditions were 1-µL injection volume, a 20-to-1 split ratio, and He carrier gas flow of 6 mL min–1. Temperatures were 250, 200, and 275°C for the injector, oven and FID, respectively. Chromatograms were analyzed by HP ChemStation software.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Structural Organization of the Soybean Soluble {Delta}9 Stearoyl-ACP Desaturase
Two 3648-bp genomic fragments were identified from soybean cultivar Dare in a shotgun cloning experiment using PCR primers designed to terminal sequences of a soluble, {Delta}9 stearoyl-ACP desaturase cDNA (accession no. L34346) from soybean. Sequencing and analysis of these fragments revealed the Glycine SACPD gene structure (Fig. 1A ) to be the following: a 111-bp exon 1 sequence encoding a putative 37 amino acid transit sequence; a 1763-bp intron 1; a 504-bp exon 2 sequence encoding 168 amino acids; a 423-bp intron 2; and a 618-bp exon 3 sequence encoding 206 amino acids. The nucleotide and amino acid sequence data of the Dare SACPDs can be found at the GenBank database as accession numbers AY885234 (SACPD-A) and AY885233 (SACPD-B).


Figure 1
Figure 1
View larger version (100K):
[in this window]
[in a new window]
 
Fig. 1. The soluble {Delta}9 stearoyl-ACP desaturase (SACPD) gene from soybean. A. Gene structural organization showing exon 1, encoding a transit peptide, exons 2 and 3, and introns 1 and 2. Exon 3 contains the region of amino acid sequence variability in G. max SACPDs. B. Alignment of Glycine max cultivar Dare SACPD-A and SACPD-B protein sequences with SACPD protein sequences from Arabidopsis Ab (AAB64035), Ricinus communis (castor bean) Cb (X56508), and a Glycine max EST, Gm (L34346).

 
Translation of the 1233-bp transcript predicts a protein of 411 amino acids with a molecular mass of 47.2 kDa and a pI of 6.02. The amino acid sequence of the Dare SACPDs was scanned with the program TMpred (Hoffman and Stoffel, 1993) and found not to contain transmembrane spanning sequences. Alignments of Glycine max SACPD deduced amino acid sequences (Fig. 1B) with SACPDs from Arabidopsis and Ricinus (castor bean) indicates a high degree of sequence conservation. The Dare SACPDs have 67 and 71% sequence identity with A. thaliana (AAB64035) and R. communis (X56508) SACPDs, respectively. G. max SACPD-A and -B have 83% sequence identity with the database G. max sequence L34346. SACPD-A and SACPD-B are 98% identical in amino acid sequence. Amino acid variations were found in exon 3, but not in exon 1 and 2 of the two Dare SACPDs. At position 210, SACPD-A has alanine; SACPD-B has threonine. At position 258, SACPD-A has glutamic acid; SACPD-B has glycine. At position 306, SACPD-A has asparagine; SACPD-B has aspartic acid. At position 310, SACPD-A has asparagine; SACPD-B has serine. At position 313, SACPD-A has alanine; SACPD-B has serine. At position 356, SACPD-A has valine; SACPD-B has isoleucine. At position 374, SACPD-A has glycine; SACPD-B has valine. These findings suggest that there are at least two SACPD genes, GmSACPD-A and GmSACPD-B in cultivar Dare. Interestingly, the primary sequence of G. max accession L34346 fits neither the amino acid substitution pattern SACPD-A nor -B exactly.

Alignment of Other Soybean SACPD Exon 3 Sequences
To assess the significance of the amino acid variability found in the SACPD exon 3s of Dare, other Gm SACPD exon 3s were PCR cloned and sequenced. We sequenced an exon 3 from Gm cultivar Bragg and an exon 3 from N01–3544, a mid-oleic acid Gm line. To these sequences were added 5 soybean cDNA exon 3-derived sequences from the GenBank database. Nucleic acid alignments for bp positions 3183 to 3211 in exon 3, depicted in Fig. 2A , show that the nine SACPD exon 3 sequences can be differentiated into two groups: Dare-A, Bragg, N01–3544, AW 755581, and BG 882246 (Williams) designated group A, and Dare-B, AI 941223 (Williams), BI 471396 (also Bragg), and BG 363272 designated group B. Amino acid alignments of the corresponding region of the exon 3s (position 307–321) revealed that variation in amino acids at position 310 and 313 permit exactly the same group A and B differentiation. Moreover, both SACPD-A and -B sequences were represented for cultivars Bragg (our sequence and BI 471396) and Williams (BG 882246 and AI 941223). On the basis of these results, we hypothesized that soybean possesses at least two SACPD genes.


Figure 2
View larger version (52K):
[in this window]
[in a new window]
 
Fig. 2. SACPD exon 3 sequence alignments. A. Nucleotide (Blastn) and B. Protein (Blastx) sequences of a section of SACPD exon 3 from 9 Glycine lines showing nucleotide and amino acid sequence variation. Sequences of Bragg-A, N01–3544, and Dare A and B were determined in this study. AW 755581, an EST of cultivar Jack, BG 882246 and AI 941223, ESTs of cultivar Williams, BI 471396, an EST of cultivar Bragg-B, and BG 363272, an EST of cultivar Corolla are GenBank accessions.

 
Detection of SACPD-A and -B in Glycine
PCR primers specific for SACPD-A and -B were designed on the basis of the nucleic acid sequences encompassing the region of variability in exon 3. These primer sets were also designed to be used for quantitative reverse transcription (real time) PCR to assess A and B transcript accumulation. The gel in Fig. 3 shows that amplification of Dare genomic DNA with primer set A produces a PCR product of 133-bp diagnostic for SACPD-A, and amplification of Dare genomic DNA with primer set B produces a product of 111-bp diagnostic for SACPD-B. Two distinct bands were observed when Dare genomic DNA, digested with either BamHI or EcoRI (Fig. 4 ), was hybridized with SACPD-A and -B exon-specific probes. These results suggest that there are at least two copies of each gene in the Dare soybean genome. Soybean is considered to be a stable allo-tetraploid with diploidized genomes (2n = 4x = 40) (Singh and Hymowitz, 1988). As an allo-tetraploid, modern soybean was produced by the hybridization of two species resulting in the union of two separate chromosome sets and their subsequent doubling giving the appearance of a normal diploid. Thus, duplication (two copies) of each SACPD structural gene was not unexpected. Since our data suggested that the genome of Glycine possesses both SACPD-A and -B, a survey of the genomes of 51 Glycine lines and cultivars was undertaken to determine gene A and B distribution. Glycine lines and cultivars in the survey (Table 1) represent different maturity groups, different stearate and oleate seed fatty acid compositions, include G. soja ancestral lines, and include the main contributors to the gene pool of modern G. max through 1988 (Gizlice et al., 1994). Table 1 shows that both SACPD gene A and B were present in all 51 Glycine lines and cultivars.


Figure 3
View larger version (91K):
[in this window]
[in a new window]
 
Fig. 3. Ethidium bromide stained gel showing amplicons produced by PCR using EcoR1 restricted Dare genomic DNA template with SACPD gene-specific primers (see Materials and Methods). Lane 1, 100bp DNA ladder; lane 2, 133-bp product produced with the SACPD-A primer pair; lane 3, 111-bp product produced with the SACPD-B primer pair.

 

Figure 4
View larger version (74K):
[in this window]
[in a new window]
 
Fig. 4. Southern blots of Dare soybean cultivar genomic DNA hybridized with SACPD-A and SACPD-B exon 3 specific probes. Lane (1), genomic DNA digested with BamHI and lane (2), with EcoRI. Molecular size (kb) is indicated on the left.

 

View this table:
[in this window]
[in a new window]
 
Table 1. Detection of SACPD-A and -B genes in Glycine cultivars and lines that were typed by PCR with gene-specific primer pairs.

 
Relative Expression of GmSACPD-A and GmSACPD-B in Stages of Seed Development and Tissues
For seed stage expression experiments, seeds and roots were harvested from plants grown under near optimal moisture, light, and temperature conditions provided by a growth chamber in the Southeastern Environmental Research Center at N.C. State University, Raleigh. We measured steady state transcript levels for SACPD-A and -B, a condition that reflects the maintenance of a constant transcript level, to determine whether the expression of one gene might differ from the other. The actin normalized pattern of SACPD-A and -B transcript accumulation at three seed developmental stages of cultivar Dare at 18, 28, and 35 DAF was essentially parallel and transcript accumulation equal (Fig. 5 ). At stage 2, 23 DAF, SACPD-A transcript accumulation was approximately 30% greater than –B, however. By way of comparison, both SACPD-A and -B stage-specific accumulation were equal but of very low abundance (5–6%) in root tissue. Differences between SACPD-A and -B transcript accumulation in greenhouse-grown, nonseed tissues, while quantifiable, were not dramatic (data not shown). SACPD-B was higher (78 and 75%) in abundance than -A (70 and 68%) in pod tissue at 18 and 35 DAF, respectively. SACPD-A and -B transcripts were similar in abundance (72%) in both young and mature leaves.


Figure 5
View larger version (22K):
[in this window]
[in a new window]
 
Fig. 5. Relative expression of cultivar Dare GmSACPD-A and GmSACPD-B at four stages of soybean seed development (between R5 and R6) at 18, 23, 28, and 35 DAF. Steady state mRNA levels were determined by real-time PCR after reverse transcription of total RNA. The values represent the percent of each gene normalized to the housekeeping gene actin. Bars indicate the standard error of the mean.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The soluble {Delta}9 stearoyl-ACP desaturase of soybean, like all the soluble desaturases using acyl-ACP substrates, is localized to the stroma fraction of plastids in developing seeds (Murphy and Piffanelli, 1998). A short N-terminal transit peptide of 37 amino acids was identified for the soybean SACPDs that is presumably responsible for stroma targeting (Fig. 1A). Most of our knowledge about plant {Delta}9 stearoyl-ACP desaturases (SACPDs) comes from the study of the soluble enzyme from castor seed (Lindqvist et al., 1996). Structure analysis of the crystallized protein shows it to be a µ-oxo-bridged di-iron enzyme that belongs to the structural class I of large helix bundle proteins that catalyzes the NADPH and O2–dependent insertion of a cis-double bond between C-9 and C-10 positions in stearoyl-ACP (Moche et al., 2003). The enzyme is a homodimer with each mature subunit of 41.6 kDa containing an independent binuclear iron cluster. At the core of the desaturase structure, two iron atoms are coordinated within a central four helix bundle in which the motif (D/E)-E-X-R-H is present in two of the four helices (Ohlrogge and Browse, 1995). During the desaturation reaction, the two-electron reduced, di-iron center binds oxygen and the high valent iron-oxygen complex formed abstracts hydrogen from the substrate C–H bond (Whittle and Shanklin, 2001).

Inspection of G. max SACPD exon 3 protein sequences derived from cDNA data suggested that soybean contains two SACPD genes (Fig. 2A and B). On the basis of the amino acid variable region of exon 3, what we now call SACPD-A and -B were found in cultivar Williams. Further sequence analysis of exon 3 clones from cultivars Dare and Bragg indicated that they also contained SACPD-A and -B. Sequence analysis of Dare genomic clones confirmed that there are two different, soluble SACPD genes in this cultivar. Amino acid variability was found only in the Dare protein sequence of exon 3 and not in the transit peptide region (exon 1) or in exon 2. Previously, multiple plant genes were identified only for microsomal desaturases. For example, three different microsomal {Delta}12 oleate desaturase genes (FAD2s) were reported for sunflower (Martinez-Rivas et al., 2001), and two microsomal FAD2s were reported each for soybean (Heppard et al., 1996) and for cotton (Liu et al., 1997), while three different microsomal {omega}-3 desaturase genes (FAD3s) were reported for soybean (Bilyeu et al., 2003).

Rather dramatic differences in microsomal desaturase gene expression levels and gene distribution have been found in soybean. Of the two soybean FAD2 genes, FAD2–1 was expressed specifically in seeds, and FAD2–2 was expressed in all tissues (Heppard et al., 1996). Only one of the three soybean FAD3 genes, FAD3A, was predominatly expressed in developing seeds (Bilyeu et al., 2003). In the same study, Bilyeu et al. (2003) found that the low linolenic acid breeding line A5 contained two of the FAD3 genes but lacked a third gene, FAD3A. In our study, we found that the differences between the transcript abundance of the soluble SACPD-A and -B in soybean tissues, while quantifiable, were not dramatic (Fig. 4 and 5). However, both soybean SACPDs were much more highly expressed in seeds than in roots.

We thought that Glycine lines–cultivars might be identified that lacked one of the SACPD genes; however, both A and B genes were found in the genomes of all 51 Glycine lines–cultivars examined (Table 1). Group I consisted of eight G. max cultivars and lines of varying maturity, including the high stearic acid mutant A6 and the midoleic acid line NO1–3544, group II consisted of eight maturity group V G. soja lines varying in oleic acid content, and group III consisted of the 35 soybean cultivars of Gizlice et al. (1994). Group III genotypes were chosen because they define the genetic base of North American soybean cultivars and represent 95% of the genes found in modern cultivars. Although GenBank accession L34346 may be indicative of a third soybean SACPD gene, efforts to find this sequence in cultivar Dare were unsuccessful. Since the primary sequence of L34346 fits the amino acid substitution pattern of neither SACPD-A nor -B exactly, L34346 may represent an allelic form of one of the two SACPD genes.

The manipulation of fatty acid desaturases to achieve a desired fatty acid composition in soybean oil has a strong rationale. Support for this rationale comes from research that has shown that downregulation of the {Delta}-12 fatty acid desaturase gene FAD2–1 elevates oleic acid content in the oil. Transgenic seeds with oleic acid content of approximately 75 to 80% of the total oil have been recovered after this gene was silenced in somatic embryos (Kinney, 1997) or the gene transcript was ribozyme-terminated (Buhr et al., 2002). As mentioned previously, the low linolenic acid breeding line A5 was found to lack the FAD3A gene at the Fan locus in soybean (Bilyeu et al., 2003). In addition, FAM94–41 (Spencer et al., 2003), a high stearic acid line, was found to carry a natural mutation, fasnc, at the Fas locus. On the basis of our findings, we will continue to characterize the enzymatic activity of the two soybean {Delta}9 soluble desaturases from both the wild-type Dare cultivar and the high stearic acid mutant line A6. Results from these experiments may provide a means to achieve the stable production of high stearic acid soybean oil.


    ACKNOWLEDGMENTS
 
We thank W. Novitzky (USDA-ARS, N.C. State University, Raleigh) for the analysis of soybean seed fatty acid composition and J. Rich (N.C. State University, Raleigh) for excellent technical assistance. Mention of trade names or commercial products in this article is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture.

Received for publication June 30, 2005.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 




This article has been cited by other articles:


Home page
Crop Sci.Home page
P. Zhang, J. W. Burton, R. G. Upchurch, E. Whittle, J. Shanklin, and R. E. Dewey
Mutations in a {Delta}9-Stearoyl-ACP-Desaturase Gene Are Associated with Enhanced Stearic Acid Levels in Soybean Seeds
Crop Sci., November 24, 2008; 48(6): 2305 - 2313.
[Abstract] [Full Text] [PDF]


Home page
Crop Sci.Home page
G. E. Byfield and R. G. Upchurch
Effect of Temperature on Microsomal Omega-3 Linoleate Desaturase Gene Expression and Linolenic Acid Content in Developing Soybean Seeds
Crop Sci., November 7, 2007; 47(6): 2445 - 2452.
[Abstract] [Full Text] [PDF]


Home page
Crop Sci.Home page
G. E. Byfield and R. G. Upchurch
Effect of Temperature on Delta-9 Stearoyl-ACP and Microsomal Omega-6 Desaturase Gene Expression and Fatty Acid Content in Developing Soybean Seeds
Crop Sci., July 30, 2007; 47(4): 1698 - 1704.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Byfield, G. E.
Right arrow Articles by Upchurch, R. G.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Byfield, G. E.
Right arrow Articles by Upchurch, R. G.
Agricola
Right arrow Articles by Byfield, G. E.
Right arrow Articles by Upchurch, R. G.
Related Collections
Right arrow Soybean
Right arrow Seed Physiology
Right arrow Crop Genetics


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
The SCI Journals Agronomy Journal Vadose Zone Journal
Journal of Natural Resources
and Life Sciences Education
Soil Science Society of America Journal
Journal of Plant Registrations Journal of
Environmental Quality
The Plant Genome