Published online 23 September 2005
Published in Crop Sci 45:2212-2217 (2005)
© 2005 Crop Science Society of America
677 S. Segoe Rd., Madison, WI 53711 USA
GENOMICS, MOLECULAR GENETICS & BIOTECHNOLOGY
Structure of Flavonoid 3'-Hydroxylase Gene for Pubescence Color in Soybean
Kyoko Todaa,
Maiko Akasakab,
Emilyn G. Dubouzeta,
Shinji Kawasakic and
Ryoji Takahashia,*
a National Institute of Crop Science and University of Tsukuba, Kannondai 2-1-18, Tsukuba, Ibaraki, 305-8518 Japan
b National Agric. Research Center, Tsukuba, Ibaraki, 305-8666 Japan
c National Institute of Agrobiological Sciences, Tsukuba, Ibaraki, 305-8602 Japan
* Corresponding author (masako{at}affrc.go.jp)
 |
ABSTRACT
|
|---|
The T locus of soybean [Glycine max (L.) Merr.] controls pubescence and seed coat color and it is presumed to encode a flavonoid 3'-hydroxylase (F3'H). Dominant T and recessive t allele of the locus produce tawny and gray pubescence, respectively. Alleles at the T locus are associated with chilling tolerance. We previously cloned the entire cDNA of F3'H gene (sf3'h1) from soybean. In this report, the entire F3'H gene was characterized by isolating two genomic clones covering the entire gene. Sequence analysis revealed that F3'H gene consists of three exons and two introns distributed in a 8500-bp DNA segment. The promoter region of the F3'H gene contains a putative G-box, two MYB-binding domains, and TA-repeats. The structure and number of the TA repeats was cultivar-dependent and highly polymorphic. A pair of simple sequence repeat (SSR) primers designated as SoyF3'H was developed to flank the TA-repeats. The SSR band polymorphism cosegregated with genotypes at T locus in 89 F2 plants segregating for the T locus. The SSR marker may be a useful internal marker of the F3'H gene and is applicable even among cultivars with similar pubescence color. The promoter sequence information obtained in this report may be useful for investigations on the transcriptional control of F3'H gene as well as transgenic experiments to clarify the relationship between F3'H gene and chilling tolerance in soybean.
Abbreviations: bp, base pair F3'H, flavonoid 3'-hydroxylase kb, kilobase NILs, near-isogenic lines SSR, simple sequence repeat
 |
INTRODUCTION
|
|---|
SOYBEAN cultivated at high latitudes and altitudes frequently suffers from low temperatures. Chilling stress retards growth, causes abortion of flowers and immature pods, and reduces the final seed yield (Raper and Kramer, 1987). Furthermore, chilling temperatures (about 15°C) during flowering induce browning and cracking of seed coats (Sunada and Ito, 1982). Cultivars with yellow hilum color compared to those with brown hilum are preferred in Japan for confectionary use due to better external appearance. However, yellow hilum cultivars are more susceptible to low temperatures resulting in reduced seed yield compared with brown hilum cultivars. Further, seed coat pigmentation occurs only in yellow hilum cultivars and is absent in cultivars with brown hilum (Sunada and Ito, 1982; Takahashi, 1997).
In Japan, cultivars with brown and yellow hilum generally have tawny and gray pubescence, respectively. Soybean breeders in Hokkaido (northern Japan) have observed that chilling tolerance is associated with pubescence color rather than hilum color based on the observation of chilling tolerance of populations segregating for both hilum and pubescence color. Takahashi and Asanuma (1996) evaluated chilling tolerance of a pair of near-isogenic lines (NILs) for pubescence color, To7B with tawny pubescence (TT), and To7G with gray pubescence (tt). Seed yield under the control condition was similar between the NILs. In contrast, seed yield of To7B and To7G under chilling treatment (15°C for 4 week) was 24 and 45% less than control, respectively. Further, N2-fixing ability, as indicated by nitrogenase activity in root nodules was similar in both NILs under the control conditions, and N2-fixing ability in To7B and To7G under chilling treatments was 40 and 57% less than control, respectively. Pod number, an indicator of pollen sterility, was similar in both the NILs under chilling treatment as well as control conditions (Takahashi and Asanuma, 1996). Takahashi et al. (2005) further investigated chilling tolerance of NILs of Harosoy for the T locus and obtained similar results. Probably, the dominant T allele is associated with chilling tolerance by improving seed-filling ability under chilling conditions.
To investigate the role of genes T and I (responsible for distribution of seed coat color, reviewed by Palmer et al., 2004) on low temperatureinduced seed coat pigmentation and cracking, Takahashi and Asanuma (1996) and Takahashi (1997) compared Harosoy and its NILs for the two loci. Independent of the genotypes at I locus, the dominant T allele completely suppressed the development of low temperatureinduced pigmentation around the hilum region and partly suppressed seed coat cracking. Dominant I allele also suppressed seed coat pigmentation and cracking under the genotype of tt, although its inhibitory effect was not as obvious as gene T. Thus, T gene is presumed to be associated with chilling tolerance in terms of yield and quality of seeds.
Based on the results, breeders at Tokachi Agric. Exp. Stn. have started to develop yellow hilum cultivars with tawny pubescence to improve chilling tolerance of yellow hilum cultivars (Kurosaki et al., 2004). Cultivars with IITT genotype frequently have dull graybrown discoloration over the entire seed coat especially when cultivated under cool summer conditions (Cober et al., 1996). Further, cultivars with IIrrTT genotype have imperfect yellow hilum: hilum color ranges from yellow to brown depending on the genetic background and environmental conditions (Cober et al., 1998). Degree of graybrown discoloration depends on the genetic background similar to hilum color (Kurosaki and Yumoto, 2001). Thus, it may be possible to develop chilling-tolerant cultivars with clear yellow seed coat and tawny pubescence.
Gene T is involved in flavonoid biosynthesis and is presumed to encode a F3'H that hydroxylates the 3'-position of the B-ring in flavonoids (Buttery and Buzzell, 1973). Toda et al. (2002) cloned and characterized the F3'H cDNA from To7B and To7G. Sequence analysis revealed that they differed by a single-base deletion of C in the coding region of To7G. The deletion generated a truncated polypeptide lacking the GGEK consensus sequence and the heme-binding domain resulting in a nonfunctional protein.
The mechanism for the relationship between T gene and chilling tolerance is controversial. Morrison et al. (1994) presumed that pubescence color might influence the microclimate of the canopy and consequently affect seed yield. Schori and Gass (1994) attributed the association to linkage between a gene controlling flowering synchronism and T locus: asynchronous flowering habit associated with dominant T allele has a compensatory role in pod setting under chilling conditions. Takahashi (1997) postulated that the dominant T allele suppresses low temperatureinduced pigmentation by inhibiting the oxidation of phenolic compounds. The F3'H gene produces flavonoids with 3', 4'-dihydroxy configuration, and these flavonoids possess a high antioxidant activity relative to those with a single hydroxyl group on the B-ring (Pratt, 1976). Varietal differences in N2-fixation ability of root nodules under chilling treatment could also be explained by the anti-oxidative activity of the flavonoids with 3', 4'-dihydroxy configuration.
The roles of genes closely linked to F3'H gene or residual heterogeneity cannot be completely excluded because the NILs were developed by crossing and selfing. Furthermore, existence of genetic rearrangements was suggested in the vicinity of T locus (Toda et al., 2002; Zabala and Vodkin, 2003). Transgenic experiments using the F3'H cDNA may be useful to differentiate the contribution of F3'H gene from closely linked genes, and clarify the function of F3'H in relation to chilling tolerance. This study was conducted to characterize the structure of the entire F3'H gene in soybean.
 |
MATERIALS AND METHODS
|
|---|
Plant Materials
Soybean NILs for T gene, To7B (tawny pubescence, TT) and To7G (gray pubescence, tt), were developed at Tokachi. Agric. Exp. Stn. by crossing T207 (tt) with Toshidai-7910, a landrace of Sakhalin (TT) (Takahashi and Asanuma, 1996). Genomic DNA was extracted by CTAB method (Murray and Thompson, 1980) from trifoliolate leaves of To7B (TT), Karafuto-1 (landrace of Sakhalin, TT), Moshidou Gong 503 (Chinese forage cultivar, TT), Clark (U.S. cultivar, TT), To7G (tt), Toyosuzu (Japanese cultivar, tt), Misuzudaizu (Japanese cultivar, tt), and Harosoy (Canadian cultivar, tt). For genetic analysis, Karafuto-1 was crossed with Toyosuzu, and seeds of F2 population were obtained by selfing. Genomic DNA was extracted from leaves of 89 F2 plants grown in the field. Genotypes at T locus of F2 plants were determined using 15 plants each from 89 F3 families.
Isolation of F3'H Genomic Clones
Genomic Southern analysis with BamHI digestion produced an intense band with approximate molecular size of 4 kb that cosegregated with pubescence color (Toda et al., 2002). In this report, BamHI-digested genomic DNA fragments of To7B were separated by electrophoresis in 1% low-melting agarose. DNA fragments with approximate size of 4 kb were excised from the gel, and the DNA was extracted using GELase according to the manufacturer's instructions (EPICENTRE Biotechnologies, Madison, WI). The extracted DNA was cloned into the BamHI site of ZAP Express vector (Stratagene, La Jolla, CA) and a minigenomic library was constructed. Plaque hybridization was performed using the entire cDNA of soybean F3'H (sf3'h1, Toda et al., 2002) as a probe according to standard procedures (Sambrook and Russell, 2001).
To investigate the varietal differences in DNA sequences, the first intron of To7G and the promoter region of To7G, Karafuto-1, Moshidou Gong 503, Clark, Toyosuzu, Misuzudaizu, and Harosoy were amplified by PCR and cloned into TA cloning vector (Invitrogen, Carlsbad, CA). PCR primer information and approximate position in the F3'H gene are presented in Table 1 and Fig. 1
, respectively.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 1. Structure of flavonoid 3'-hydroxylase gene in soybean near-isogenic line, To7B. The entire F3'H gene is covered by two genomic clones, F3'H-G1 and F3'H-G2. PCR primer positions are indicated by small arrows. Designation of the primers is shown to the left of each primer pair. Information of the primers is presented in Table 1. The F3'H gene consists of three exons and two introns.
|
|
DNA Sequencing and Motif Analysis
Nucleotide sequences of both strands were determined with BigDye terminator cycle method using a Genetic Analyzer ABI3100 (Applied Biosystems, Foster City, CA). Nucleotide sequences were analyzed with the BLAST program (Altschul et al., 1997). Motif analysis of the putative promoter region was performed using the PLACE Signal Scan Search software (Higo et al., 1999).
SSR Analysis
The PCR mixture contained 50 ng of genomic DNA, 4.5 pmol of each primer, 2 nmol of nucleotides, and 0.25 unit of ExTaq in 1x ExTaq buffer supplied by the manufacturer (TAKARA BIO, Ohtsu, Japan) in a total volume of 10 µL. The initial 12 min denaturation at 94°C was followed by 28 cycles of 30 sec denaturation at 94°C, 30 sec annealing at 54°C, and 30 sec extension at 68°C. A final 5 min extension at 68°C completed the program. The PCR was performed in an Applied Biosystems GeneAmp 9700 thermal cycler. The PCR products were mixed with an equal volume of formamide dye (96% formamide, 10 mM EDTA, 0.025% bromophenol blue, 0.025% xylene cyanol), denatured by heating for 3 min at 90°C, and chilled on ice. Electrophoresis was performed using the HEGS (high efficiency genome scanning) system (Kawasaki and Murakami, 2000). The 7% denaturing polyacrylamide gels with 8.5 M urea were preheated by running at 100 V for 30 min at 50°C in an incubator. Six microliters of each denatured sample was loaded on the gels and electrophoresed at 120 V for 3 h at 50°C in the incubator. The fragments were visualized by ethidium bromide staining.
 |
RESULTS AND DISCUSSION
|
|---|
Isolation of F3'H Genomic Clones
As expected by genomic Southern analysis, the positive clone (F3'H-G1) in plaque hybridization contained an insert of approximately 4.2 kb. Sequence analysis revealed that the clone included two exons corresponding to 473 to 1644 bp of sf3'h1 cDNA (DDBJ accession number: AB061212) separated by a 901-bp intron, and it lacks the upstream region (Fig. 1). The clone was presumed to contain the region downstream from the middle of an intron. To clone the upstream genomic region, genomic Southern analysis was performed using restriction enzymes producing compatible ends with BamHI (BclI and BglII) using the upstream region (the region from 1 to 515 bp) of the sf3'h1 clone as a probe. BclI digestion produced a positive band with approximate molecular size of 4.9 kb. A mini-library was constructed using the DNA fragments corresponding to the positive band size into the ZAP Express vector. One clone was chosen by plaque hybridization as a candidate. Sequence analysis revealed that the clone with molecular size of about 4.9 kb (F3'H-G2) contained the first exon corresponding to 1 to 472 bp of sf3'h1 cDNA and approximately 1.5 kb upstream from the start codon. The two clones from the genomic library, F3'H-G1 and F3'H-G2, have an overlapping region of 644 bp and the DNA sequence of this region was identical in these two clones. Cloning and sequence analysis of the region spanning these two clones using the PCR primer no. 7 (Fig. 1 and Table 1) confirmed that the two clones were derived from a single gene and that the two clones cover the entire F3'H gene.
Structure of the F3'H Gene
Sequence analysis of the two genomic clones revealed that soybean F3'H gene consisted of three exons and two introns (Fig. 1). DNA sequences were deposited in the DDBJ database under the accession numbers of AB191404 (entire gene in To7B), AB191405 (5'-upstream region in To7G) and AB191406 (first intron in To7G). The first intron of To7B is 4114 bp long and corresponds to the large intron partly examined by Zabala and Vodkin (2003). DNA sequences of the first intron differed at 14 positions between To7B and To7G (data not shown). However, the differences were either single-base Indel or single-base substitution. Large segments of recombination, deletion, or substitution were not observed.
Motif analysis of the 1.5-kb upstream region from the start codon probably corresponding to the promoter revealed a plant MYB-binding domain (AACCAAAC) at
1400 bp upstream and a G-box core sequence (CACGTG) at
1250 bp upstream of the start codon (Fig. 2)
. Further, a binding motif of plant R2R3-MYB proteins (motif type IIG; GTTTGGTA; Romero et al., 1998) and 26 TA repeats were found at
280 bp and
940 bp upstream from the start codon, respectively. MYB proteins, along with basic helix-loop-helix proteins and WD40 proteins, comprise one of the major regulatory proteins in flavonoid biosynthesis in maize (Zea mays L.), Antirrhinum, and petunia (Petunia hybrida Vilm.) (Mol et al., 1998). The consensus sequence of plant MYB-binding domain has been found in promoters of flavonoid biosynthetic genes such as phenylalanine ammonia lyase, chalcone synthase, and dihydroflavonol 4-reductase (Sablowski et al., 1994).

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 2. Motifs found in the promoter region of F3'H gene in soybean near-isogenic line, To7B. The numbers refer to the location of motifs in the DNA sequence where the A of the start codon is numbered as 1.
|
|
G-boxes, elements with the core sequence CACGTG, are found in the promoters of many genes responsive to a variety of different stimuli such as light, anaerobiosis, and abscisic acid (Terzaghi and Cashmore, 1995). AT-rich sequences are bound by nuclear proteins and have been found in numerous light-regulated promoters, including the tomato (Lycopersicon esculentum Mill.) RBCS3A, pea (Pisum sativum L.) RBCS3A, maize CAB-ml, and pea GS2 (Terzaghi and Cashmore, 1995). Function of the MYB-binding domains, G-box, and AT-rich repeats should be confirmed by in vivo assays.
Number and structure of the TA repeats differed among cultivars. TTAA was interposed within the TA repeats in To7G (tt), Moshidou Gong 503 (TT), Clark (TT), Toyosuzu (tt), and Harosoy (tt), while absent in To7B (TT), Misuzudaizu (tt), and Karafuto-1 (TT). The exact number of TA repeats could not be determined in most cultivars. Number of TA repeats generally differed by 1 to 3 among four DNA clones derived from identical cultivars even using KOD DNA Polymerase (TOYOBO, Tokyo, Japan) with high PCR fidelity. However, the number of TA repeats substantially differed among cultivars, and varietal differences were evident (Table 2). It is uncertain whether the structure or number of TA repeats is associated with the expression profile of the F3'H gene. The other regions in the promoter differed by single-base substitutions at two positions and a three-base Indel at one position among the eight cultivars (data not shown).
View this table:
[in this window]
[in a new window]
|
Table 2. Structure of TA repeats in the promoter region and expected amplicon size in SSR analysis of a pair of near-isogenic lines for T gene, To7B and To7G, and six soybean cultivars.
|
|
Construction of SSR Marker for F3'H Gene
A pair of PCR primers flanking the TA repeats (designated as SoyF3'H; forward primer, GTCATAAAATATCATTATTATTATATCTATTAA; reverse primer, CACTCCCAAAAGCTTTTAAGTGT) produced polymorphic PCR bands among cultivars (Fig. 3)
. Generally, size of the PCR band was not largely different among tawny pubescence cultivars (TT), whereas the band size was highly variable among gray pubescence cultivars (tt). The band size was approximately similar to that expected from the promoter sequences (Table 2). SSR analysis using 89 F2 plants segregating for T locus revealed that the band polymorphism cosegregated with genotypes at the T locus (Fig. 4)
. The SSR marker may be useful as an internal marker of F3'H gene even in populations when pubescence color is not different between parents.

View larger version (100K):
[in this window]
[in a new window]
|
Fig. 3. SSR band polymorphism of soybean near-isogenic lines for pubescence color, To7B (TT) and To7G (tt), and cultivars with tawny pubescence (TT, Karafuto-1, Moshidou Gong 503, and Clark) and cultivars with gray pubescence (tt, Toyosuzu, Misuzudaizu, and Harosoy) using the SSR primer, SoyF3'H. The migration of size markers is shown to the right of the gel.
|
|

View larger version (45K):
[in this window]
[in a new window]
|
Fig. 4. SSR band polymorphisms of a F2 population derived from a cross between a tawny pubescence cultivar Karafuto-1 (TT) and a gray pubescence cultivar Toyosuzu (tt) using the SSR primer SoyF3'H. Genotypes at the T locus were determined by testing 15 progeny of each F3 families. M, molecular size marker; 1, Karafuto-1; 2, Toyosuzu; T, F2 plants with TT genotype; H, F2 plants with Tt genotype; t, F2 plants with tt genotype. The SSR bands cosegregated with the genotype at the T locus. The migration of size markers is shown to the right of the gel.
|
|
The O2diffusion barrier exists in the root nodule cortex that surrounds the central zone of infected cells to maintain low O2 concentration, because nitrogenase is irreversibly inactivated by O2 (Hunt and Layzell, 1993). We hypothesize that flavonoids with 3', 4'-dihydroxy configuration having higher anti-oxidative activity may protect the O2diffusion barrier by scavenging the activated form of O2 generated under low temperature conditions in root nodules. Two consensus DNA sequences for nodulin, AAAGAT and CTCTT, were identified in soybean (Stougaard et al., 1987). The F3'H promoter contained four copies of the former motif but lacks the latter motif (data not shown). Tissue specificity of F3'H gene expression should be investigated. Detailed physiological and histological studies may be necessary to prove the anti-oxidative hypothesis. The promoter sequence information obtained in this report may be useful for investigations on the transcriptional control of the F3'H gene including the regulatory mechanism and tissue or stress specific expression. Further, the native F3'H promoter may be useful for the transgenic experiments to investigate the relationship between F3'H gene and chilling tolerance in soybean.
 |
ACKNOWLEDGMENTS
|
|---|
We thank the staff of the Soybean Breeding Laboratory, Tokachi Agric. Exp. Stn., Memuro, Hokkaido, Japan for providing the seeds of the isolines. We are grateful to Dr. S. Akada (Hirosaki University) and Dr. H. Matsumoto (University of Tsukuba) for advice, and Dr. Joseph G. Dubouzet (National Institute of Crop Science) for critical reading of the manuscript. This study was partially supported by the Grants-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology, Japan.
Received for publication October 25, 2005.
 |
REFERENCES
|
|---|
- Altschul, S.F., T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang, W. Miller, and D.J. Lipman. 1997. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 25:33893402.[Abstract/Free Full Text]
- Buttery, B.R., and R.I. Buzzell. 1973. Varietal differences in leaf flavonoids of soybeans. Crop Sci. 13:103106.
- Cober, E.R., G.R. Ablett, R.I. Buzzell, B.M. Luzzi, V. Poysa, A.S. Sahota, and H.D. Voldeng. 1998. Imperfect yellow hilum color in soybean is conditioned by II rr TT. Crop Sci. 38:940941.[Abstract/Free Full Text]
- Cober, E.R., J.A. Frégeau-Reid, and H.D. Voldeng. 1996. Soybean seed coat discoloration. Can. Soybean Tech. Bull. 1(2):2.
- Higo, K., Y. Ugawa, M. Iwamoto, and T. Korenaga. 1999. Plant cis-acting regulatory DNA elements (PLACE) databases. Nucleic Acids Res. 27:297300.[Abstract/Free Full Text]
- Hunt, S., and D.B. Layzell. 1993. Gas exchange of legume nodules and the regulation of nitrogenase activity. Annu. Rev. Plant Physiol. Plant Mol. Biol. 44:483511.[CrossRef][Web of Science]
- Kawasaki, S., and Y. Murakami. 2000. Genome analysis of Lotus japonicus. J. Plant Res. 113:497506.[CrossRef][Web of Science]
- Kurosaki, H., and S. Yumoto. 2001. Effects of temperatures during reproductive periods on color tune of hilum and seed coat in near isogenic lines for pubescence color in soybean. (In Japanese.) Rep. Hokkaido Branch, Crop Sci. Soc. Jpn. and Hokkaido Branch. Jpn. Soc. Breed. 42:155156.
- Kurosaki, H., S. Yumoto, and I. Matsukawa. 2004. Correlation of cold-weather tolerance with pubescence color and flowering time in yellow hilum soybeans in Hokkaido. Breed. Sci. 54:303311.[CrossRef]
- Mol, J., E. Grotewold, and R. Koes. 1998. How genes paint flowers and seeds. Trends Plant Sci. 3:212217.[CrossRef][Web of Science]
- Morrison, M.J., H.D. Voldeng, and R.J.D. Guillemette. 1994. Soybean pubescence color influences seed yield in cool-season climates. Agron. J. 86:796799.[Abstract/Free Full Text]
- Murray, M.G., and W.F. Thompson. 1980. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8:43214325.[Abstract/Free Full Text]
- Palmer, R.G., T.W. Pfeiffer, G.R. Buss, and T.C. Kilen. 2004. Qualitative genetics. p. 137233. In H.R. Boerma and J.E. Specht (ed.) Soybeans: Improvement, production, and uses. 3rd. ed. Agron. Monogr. 16. ASA, CSSA, and SSSA, Madison, WI.
- Pratt, D.E. 1976. Role of flavones and related compounds in retarding lipid-oxidative flavor changes in foods. p. 113. In G. Charalambous and I. Katz (ed.) Phenolic, sulfur, and nitrogen compounds in food flavors. ACS Symposium Series 26. Am. Chem. Soc., Washington, DC.
- Raper, C.D., and P.J. Kramer. 1987. Stress physiology. p. 589641. In J.R. Wilcox (ed.) Soybeans: Improvement, production, and uses. 2nd. ed. Agron. Monogr. 16. ASA, CSSA, and SSSA, Madison, WI.
- Romero, I., A. Fuertes, M.J. Benito, J.M. Malpica, A. Leyva, and J. Paz-Ares. 1998. More than 80R2R3-MYB regulatory genes in the genome of Arabidopsis thaliana. Plant J. 14:273284.[CrossRef][Web of Science][Medline]
- Sablowski, R.W.M., E. Moyano, F.A. Culianez-Macia, W. Schuch, C. Martin, and M. Bevan. 1994. A flower-specific Myb protein activates transcription of phenylpropanoid biosynthetic genes. EMBO J. 13:128137.[Web of Science][Medline]
- Sambrook, J., and D.W. Russell. 2001. Molecular cloning. A laboratory manual. 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- Schori, A., and T. Gass. 1994. Description of two flowering types and F2 segregation in relation to pubescence color. Soybean Genet. Newsl. 21:156160.
- Stougaard, J., N.N. Sandal, A. Grøn, A. Kühle, and K.A. Marcker. 1987. 5' Analysis of the soybean leghaemoglobin lbc3 gene: Regulatory elements required for promoter activity and organ specificity. EMBO J. 6:35653569.[Web of Science][Medline]
- Sunada, K., and T. Ito. 1982. Soybean grain quality as affected by low temperature treatments in plants (color of hilum, seed coat cracking). (In Japanese.) Rep. Hokkaido Branch, Crop Sci. Soc. Jpn. and Hokkaido Branch. Jpn. Soc. Breed. 22:34.
- Takahashi, R. 1997. Association of soybean genes I and T with low-temperature induced seed coat deterioration. Crop Sci. 37:17551759.[Abstract/Free Full Text]
- Takahashi, R., and S. Asanuma. 1996. Association of T gene with chilling tolerance in soybean. Crop Sci. 36:559562.[Abstract/Free Full Text]
- Takahashi, R., E.R. Benitez, H. Funatsuki, and S. Ohnishi. 2005. Soybean maturity and pubescence color genes improve chilling tolerance. Crop Sci. 45:13871393.[Abstract/Free Full Text]
- Terzaghi, W.B., and A.R. Cashmore. 1995. Light-regulated transcription. Annu. Rev. Plant Physiol. Plant Mol. Biol. 46:445474.[CrossRef][Web of Science]
- Toda, K., D. Yang, N. Yamanaka, S. Watanabe, K. Harada, and R. Takahashi. 2002. A single-base deletion in soybean flavonoid 3'-hydroxylase gene is associated with gray pubescence color. Plant Mol. Biol. 50:187196.[CrossRef][Web of Science][Medline]
- Zabala, G., and L.O. Vodkin. 2003. Cloning of the pleiotropic T locus in soybean and two recessive alleles that differentially affect structure and expression of the encoded flavonoid 3' hydroxylase. Genetics 163:295309.[Abstract/Free Full Text]
Related articles in Crop Science:
- THIS ISSUE IN CROP SCIENCE
Crop Science 2005 45: vii.
[Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
T. Iwashina, E. R. Benitez, and R. Takahashi
Analysis of Flavonoids in Pubescence of Soybean Near-isogenic Lines for Pubescence Color Loci
J. Hered.,
September 1, 2006;
97(5):
438 - 443.
[Abstract]
[Full Text]
[PDF]
|
 |
|