Crop Science
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published online 1 August 2005
Published in Crop Sci 45:1830-1836 (2005)
© 2005 Crop Science Society of America
677 S. Segoe Rd., Madison, WI 53711 USA
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Related articles in Crop Science
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bilyeu, K.
Right arrow Articles by Beuselinck, P.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Bilyeu, K.
Right arrow Articles by Beuselinck, P.
Agricola
Right arrow Articles by Bilyeu, K.
Right arrow Articles by Beuselinck, P.
Related Collections
Right arrow Soybean
Right arrow Crop Physiology & Metabolism

GENOMICS, MOLECULAR GENETICS & BIOTECHNOLOGY

Mutations in Soybean Microsomal Omega-3 Fatty Acid Desaturase Genes Reduce Linolenic Acid Concentration in Soybean Seeds

Kristin Bilyeua,*, Lavanya Palavallib, David Sleperb and Paul Beuselincka

a USDA-ARS, Plant Genetics Research Unit, Columbia, MO 65211
b Dep. of Agronomy, University of Missouri, Columbia, MO 65211

* Corresponding author (BilyeuK{at}missouri.edu)


    ABSTRACT
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
One major locus (Fan) and several minor loci have been shown to contribute to the linolenic acid level in soybean [Glycine max (L.) Merr.] seeds. The Fan gene encodes a microsomal omega-3 fatty acid desaturase (Arabidopsis FAD3 homolog), and soybeans contain three FAD3 genes. The objective of this work was to characterize candidate soybean FAD3 genes from low linolenic acid soybean lines and associate those alleles with the trait. Mutations in two of the three soybean FAD3 genes were identified, and genotypes with the mutant alleles conferred a reduction of over two thirds of the linolenic acid present in the seed. The two mutant genes contributed unequally but additively to the phenotype. The results demonstrated that the mutant genotype can be identified with mutation-specific molecular markers in the F2 generation, and the low linolenic acid trait will be stably inherited in subsequent generations.

Abbreviations: bp, base pairs • CAPS, cleaved amplified polymorphic sequence • dNTP, deoxyribonucleotide triphosphate mix • PCR, polymerase chain reaction • RT, reverse transcriptase • SNP, single nucleotide polymorphism


    INTRODUCTION
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
THE PRODUCTION of soybeans containing low linolenic acid levels in the oil fraction is desirable for the demands of modern markets. Through mutagenesis breeding, a set of soybean lines has been developed with lowered seed linolenic acid levels, and these lines have mutations at the fan locus (Wilcox and Cavins, 1985; Rennie and Tanner, 1991; Rahman et al., 1996). Other lines have been described in which lower linolenic acid phenotypes were generated, and the inheritance was characterized as multigenic (Fehr et al., 1992; Rahman et al., 1997; Rahman et al., 1998; Takagi et al., 1999; Ross et al., 2000). Successful incorporation of multiple genes at independent loci into elite lines would be enhanced by the use of molecular markers specific for the mutated genes. Mutation-specific allele markers would also enable multigenic traits to be efficiently selected in lines used for backcrossing into elite lines, decreasing the dependence on segregation of poor agronomic traits inherited from the mutated parent line with the desired trait.

Omega-3 fatty acid desaturase enzymes introduce the third double bond into linoleic acid precursors to produce linolenic acid precursors. We previously confirmed that the Fan locus was one of the three soybean homologs (GmFAD3A) of the Arabidopsis microsomal omega-three fatty acid desaturase gene FAD3 (Bilyeu et al., 2003). GmFAD3A was also characterized as the most highly expressed of the three homologs in developing seeds. The relative importance of GmFAD3B and GmFAD3C to seed linolenic acid levels has not yet been described, although they have been shown to be expressed at low levels in developing seeds (Bilyeu et al., 2003). Nuclear-encoded, chloroplast-targeted omega-three fatty acid desaturases may also contribute to seed linolenic acid levels (Yadav et al., 1993). Omega-3 fatty acid desaturases are members of an enzyme family characterized by the presence of a diiron cofactor which interacts with three regions of conserved histidine motifs in the protein (Shanklin et al., 1994).

The low linolenic acid soybean line CX1512-44 was previously developed from a mutagenesis breeding program (James Wilcox, pers. comm.). Although dependent on the environmental growth conditions, CX1512-44 seeds typically contain about 3% (30 g kg–1 oil) linolenic acid, while wild-type lines contain about 7 to 10% (70–100 g kg–1 oil) linolenic acid. On the basis of segregation analysis of the fatty acid composition phenotype of F2 progeny from crosses between CX1512-44 and lines with wild-type linolenic acid levels, the low linolenic acid trait was presumed to be multigenic (data not shown). A genetic characterization of CX1512-44 has not been described in the literature. The objective of this work was to characterize candidate soybean FAD3 genes from low linolenic acid soybean lines and associate those alleles with the trait. We previously determined that soybean contained three microsomal omega-3 fatty acid desaturase genes. We confirmed by sequence analysis that the three CX1512-44 FAD3 genes were candidates for genetic lesions associated with the low linolenic acid trait. In addition, we were able to associate the linolenic acid level phenotype and the FAD3 genotype for progeny of crosses derived from CX1512-44.


    MATERIALS AND METHODS
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cloning and Sequence Analysis
Primers were designed on the basis of the sequences deposited in the GenBank to amplify soybean GmFAD3A (AY204711), GmFAD3B (AY204712), and GmFAD3C (AY204713) cDNAs from line CX1512-44. Reverse transcriptase reactions, PCR amplification, isolation of products from agarose gels, and cloning were as previously described (Bilyeu et al., 2003).

Plant Growth
The 3% linolenic acid line 2721 was an F6–derived line produced from a cross between Pana and CX1512-44. Line 2721 was homozygous for the CX1512-44 mutant alleles of GmFAD3A and GmFAD3C. Seeds of a ‘Williams 82’ (Bernard and Cremeens, 1988) x 2721 cross and A5 (Rennie and Tanner, 1991) x 2721 were produced in Costa Rica in 2003. F1 and F2 plants were germinated in moist packets and transferred to soil for growth in growth chambers set at 27.5/23°C day/night with 14.5 h daylength. The light intensity was 750 µmol m–2 s–1. F4 seeds were produced in a greenhouse in the spring of 2004 without supplemental lighting.

Phenotype Analysis
For fatty acid determination, chips were made distal to the embryonic axis (approximately 20% of the seed) of individual F2 seeds and the parent line seeds, and the portions containing the embryonic axis were saved for germination. For the F3 seed fatty acid determination, 10 F3 seeds from each F2 line were crushed and analyzed individually. The only exception was for genotype aaCC, where aa represents mutant alleles at FAD3A and CC represents wild-type alleles at FAD3C, for which only five seeds were used. F4 seeds (n = 3) from three F3 plants representing three independent aacc genotypes were crushed and analyzed individually. The concentration of linolenic acid in the sample was determined as a percentage of the total fatty acids of the seed by lipid gas chromatography of fatty acid methyl esters of extracted oil. Crushed seeds were extracted in 0.5 mL (for chips) or in 1 mL (for single seeds) chloroform:hexane:methanol (8:5:2, v/v/v) overnight. Derivitization of 0.5-mL chip solvent or 150-µL single seed solvent was done with 75 µL methylating reagent (0.25 M methanolic sodium methoxide:petroleum ether:ethyl ether, 1:5:2, v/v/v). For single seeds, samples were diluted with hexane to approximately 1 mL. An Agilent (Palo Alto, CA) series 6890 capillary gas chromatograph fitted with a flame ionization detector (275°C) was used with an AT-Silar capillary column (Alltech Associates, Deerfield, IL). Standard fatty acid mixtures (Animal and Vegetable Oil Reference Mixture 6, AOACS) were used as calibration reference standards.

Detection of Mutant Alleles
For both the CX1512-44 GmFAD3A and GmFAD3C alleles, a detection method for SNPs was developed on the basis of the McSNP assay (Ye et al., 2002). The assays are based in principle on cleaved amplified polymorphic sequence (CAPS) assays (Konieczny and Ausubel, 1993), where the genomic region of interest is first amplified by PCR followed by a restriction enzyme digestion which distinguishes the wild-type and mutant alleles. We utilized a real-time PCR instrument (MJ Research Opticon, Waltham, MA) and the double-stranded DNA binding dye SYBR Green I (Molecular Probes, Eugene, OR) for a melting curve analysis so that PCR digestion products could be characterized without separation on agarose gels. For GmFAD3A, the primers were 3AD1 (TTGCATCACCATGGTCATCAT) and 3AIX (AGCTATTATCTAGCATTAACCTCA). For GmFAD3C, the primers were 653Dup (GTCCTTTGTTGAACAGCATT) and 653T (CTCCTGCAAAAAATCCATGAGTTGT). While 3AD1 and 653Dup were derived from cDNA sequences, 3AIX and 653T were derived from intron sequences to increase priming specificity. Scoring for a deletion of GmFAD3A was by resolution of one or three products after PCR with primers that allowed amplification of 153 bp of the GmFAD3A gene as well as a 165-bp product from the GmFAD3B gene using the primers 387start (AGCAATGGTTAAAGACACAAAG) and 387testab (AGGGATCTCCATGGATTCTTGA). For genotypes with both copies of GmFAD3A deleted, a single band was produced, whereas when GmFAD3A was present in one or two copies, three bands were produced (one each for GmFAD3A and GmFAD3B as well as a slower-migrating band that was a hybrid of the two products). PCR templates consisted of 2 mm washed FTA (Whatman, Clifton, NJ) card punches prepared from leaves according to the manufacturer's instructions. The 15-µL reactions for PCR contained template, buffer (40 mM Tricine-KOH (pH 8.0), 16 mM KCl, 3.5 mM MgCl2, 3.75 µg mL–1 BSA, 200 µM dNTPs), 10% (v/v) DMSO, 0.5 µM each primer, 0.25x SYBR Green I, and 0.2x Titanium Taq polymerase (BD Biosciences, Palo Alto, CA). Amplification conditions were 95°C for 5 min, 35 cycles of 95°C for 20 s, 60°C for 20 s, 72°C for 20 s. Restriction enzyme reactions were performed for 14 to 18 h in the same tube after the addition of 30 µL of a mix containing 20 µL 2x MaeIII buffer (Roche Applied Science, Indianapolis, IN), 9.85 µL ddH2O, and 0.15 µL MaeIII (1.67 U µL–1, Roche Applied Science, Indianapolis, IN) for GmFAD3A or 3.5 µL 10x buffer 2 (New England Biolabs, Beverly, MA), 26.3 µL ddH2O, and 0.2 µL NcoI (10 U µL–1, New England Biolabs, Beverly, MA) for GmFAD3C. GmFAD3A MaeIII reactions were incubated at 55°C, while GmFAD3C NcoI reactions were incubated at 37°C. Melting curve analsyis followed restriction enzyme digestion of PCR products with parameters of 70 to 90°C with 0.2°C increases and reads every 1 s. For GmFAD3A, wild-type alleles (100- and 48-bp products) produced a peak at 78°C, mutant alleles produced a peak at 82.5°C (148 bp) and heterozygotes produced both peaks (148, 100, and 48 bp). For GmFAD3C, wild-type alleles (134- and 59-bp products) produced a peak at 79.5°C, mutant alleles produced a peak at 81.5°C (193 bp) and heterozygotes produced both peaks (193, 134, and 59 bp). In some cases, products were resolved on 1.5% (w/v) agarose gels.


    RESULTS
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Characterizing the CX1512-44 GmFAD3A, GmFAD3B, and GmFAD3C Genes
Immature seed or leaf tissue from the CX1512-44 line was used as a source of RNA for amplification of cDNA sequences for GmFAD3A, GmFAD3B, and GmFAD3C (Bilyeu et al., 2003) by reverse transcriptase PCR (RT-PCR). Amplification of subsections of GmFAD3A produced products of unanticipated sizes. Sequencing of clones of these products revealed mRNA missplicing events in the 3' half of the gene, specifically the activation of a cryptic 5' splice site in one case and the complete exclusion of an exon in another. The amplification of these products supported the exon-definition model of splicing plant introns (Simpson et al., 1999), and pointed to a potential splice-site lesion. Evaluation of the target DNA sequence from genomic DNA, which corresponds to the sixth intron of the Arabidopsis FAD3 gene, exposed a G to A transition (Fig. 1) in a consensus splice-site sequence (Brown et al., 1996) in CX1512-44 compared with Williams 82. The mutation occurred at the position following base 810 of the coding sequence, in the first base position of the putative sixth intron of GmFAD3A. Williams 82 cDNA did not appear to produce any misspliced products when amplified with the primers that revealed missplicing in CX1512-44 (data not shown). Both of the detected misspliced CX1512-44 GmFAD3A mRNAs would produce prematurely terminated protein sequences resulting from frameshifts in the coding region. Therefore, the single base mutation in the CX1512-44 GmFAD3A gene renders the desaturase enzyme nonfunctional.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 1. Identification of a splice-site mutation in the CX1512-44 GmFAD3A allele. A. schematic diagram of GmFAD3A exons (5–7, black rectangles) connected by introns (horizontal lines). Normal splicing and intron removal is represented by dashed lines above the introns. Abnormal splicing (black and gray lines below the introns) characterized CX1512-44 mRNA with either exclusion of exon 6 or activation of a cryptic splice site within an intron leading to improper expansion of exon 6 coupled to proper splicing of exons 5 and 7. A mutation in the splice site was identified at the first base following exon 6, (position denoted by an asterisk). B. Sequence comparison of Williams 82 and CX1512-44 GmFAD3A splice site following exon 6. PCR products generated from amplification of genomic DNA were cloned and sequenced. Sense sequence is listed 5' to 3', with the vertical line indicating the separation of exon 6 and intron sequence. The first base of the intron in the CX1512-44 allele is changed from G to A (underlined), mutating a consensus splice site (GXXXGT, bold, Brown et al., 1996). C. Sequence of genomic DNA from Williams 82 GmFAD3A beginning with base 763 of the cDNA sequence and including the exon 6/intron 6 boundary. Exon sequences are listed in capitals while intron sequences are lowercase. The sequences corresponding to the PCR primers used for the GmFAD3A MaeIII assay are shown in bold (see Materials and Methods). The base mutated in CX1512-44 is underlined, and the MaeIII recognition sequence (GTNAC) is in parentheses.

 
The GmFAD3B gene from CX1512-44 was also queried for putative mutations. While several polymorphisms were identified when the CX1512-44 GmFAD3B gene was compared with the genes from ‘Pana’ (Nickell et al., 1998) and Williams 82, no highly conserved amino acids were affected by the changes. We assumed that the CX1512-44 GmFAD3B enzyme was functionally equivalent to a wild-type enzyme.

The CX1512-44 GmFAD3C gene was similarly cloned and sequenced. A single nucleotide polymorphism (SNP) was identified at base 383 (a383g) of the coding sequence that alters a codon for glycine to glutamic acid (G128E) within the conserved histidine-rich region 1b of the enzyme (Shanklin et al., 1994) (Fig. 2). When the mutant peptide fragment was used as a query in a search of GenBank (tblastn), all of the identified sequences contained a glycine in the CX1512-44-mutated amino acid position. Although the deleterious effect of this particular amino acid change has not been independently demonstrated biochemically, the high degree of sequence conservation implies functional significance of the region. The identified polymorphism allows unambiguous identification of the CX1512-44 derived GmFAD3C allele.



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 2. Amino acid alignment of a portion of the soybean and Arabidopsis FAD3 protein sequences. Identical amino acids are highlighted in black while similar amino acids are highlighted in gray. The wild-type and CX1512-44 GmFAD3C (CX1512-44C) alleles are shown from amino acid 103 to 152. A SNP in the coding sequence results in a G128E mutation (indicated above the alignment with an asterisk) for the CX1512-44 allele. Histidine-rich region 1b (Shanklin et al., 1994) is underlined.

 
Association of GmFAD3 Mutations with the Low Linolenic Acid Phenotype
To investigate the association of the CX1512-44 derived GmFAD3A and GmFAD3C alleles with seed linolenic acid levels, 107 F2 progeny of a Williams 82 x 2721 cross were profiled for phenotype and genotype. The line 2721 was an F6–derived line produced from a cross between Pana and CX1512-44 that had undergone phenotypic selection and was homozygous for the GmFAD3A and GmFAD3C alleles from CX1512-44 (D. Sleper, personal communication, data not shown). This CX1512-44-derived genotype is represented as aacc, while the corresponding wild-type alleles are represented as AACC. Simple PCR-based assays were developed to distinguish mutant and wild-type alleles at the two loci. F1 plants were checked for heterozygosity by the identified polymorphisms and grown in growth chambers under defined conditions to produce F2 seeds. Individual F2 seeds were chipped for fatty acid analysis and subsequently germinated to allow genotyping from leaf tissue. An unequal, additive association was found for each copy of the mutation and the linolenic acid level (Fig. 3). A stepwise decrease in linolenic acid levels occurred as mutant alleles replaced their wild-type counterparts, with mutations in the GmFAD3A gene associating with greater reductions in linolenic acid levels than mutations in the GmFAD3C gene, consistent with GmFAD3A being the Fan locus (Bilyeu et al., 2003). The phenotype of the 2721 parent was completely recovered in the progeny with the aacc genotype. The phenotype of an individual was not sufficiently precise to predict the genotype, even when the standard deviation for phenotype of the genotype group was small.



View larger version (31K):
[in this window]
[in a new window]
 
Fig. 3. Phenotype and genotype for F2 plants segregating for GmFAD3A and GmFAD3C mutations. Histogram representing the linolenic acid phenotype of F2 soybean seeds segregating for the GmFAD3A and GmFAD3C mutations from a cross between a wild-type line (Williams 82, AACC) and a low linlolenic acid line (2721, aacc). Individual F2 seeds were chipped for fatty acid analysis, and the remainder of the seed was germinated for genotype analysis. The average phenotypes of the parent lines (n = 10) are represented in black or white bars, while the averages of all F2 progeny with the indicated genotypes are represented with gray bars. Error bars represent one standard deviation of the mean. The numbers below the genotypes represent the number of individual seeds that contributed to each phenotype average.

 
The overall reduction in linolenic acid levels contributed by mutations in both GmFAD3A and GmFAD3C was 61 g kg–1, from 89 to 28 g kg–1 linolenic acid. The mutation of the two genes thus results in the elimination of over two thirds of the linolenic acid present in the seed. Approximately half of the reduction was obtained from substitutions of a wild-type allele to a heterozygous condition and half from a heterozygous condition to homozygous mutant. By analyzing the differences in average linolenic acid levels for each of the genotypes, the average reduction in linolenic acid levels for both the GmFAD3A and GmFAD3C mutations was individually determined. As shown in Table 1, the overall average difference in linolenic acid levels between lines with wild-type (AA) or mutant (aa) GmFAD3A genes was 46 g kg–1 oil while the average differences between wild-type and heterozygous (Aa) or heterozygous and mutant GmFAD3A was approximately half the difference from wild type to mutant. The overall average difference in linolenic acid levels was smaller for the GmFAD3C gene, and the differences between heterozygous and either wild type or mutant showed some bias for a larger linolenic acid reduction from Cc to cc than CC to Cc. The range of values for linolenic acid levels in seeds segregating with wild-type alleles was higher than the range for the low linolenic acid mutant allele-containing seeds, even though all seeds were produced under defined conditions in growth chambers. The higher standard deviations for the lines with the highest linolenic acid levels and the relatively low number of F2 progeny examined (107) does not allow a rigorous testing of the significance of the bias for one allele-contributions.


View this table:
[in this window]
[in a new window]
 
Table 1. Mean difference in seed linolenic acid level for F2 progeny with allelic substitutions of wild-type (uppercase) and mutant (lowercase) alleles of GmFAD3A and GmFAD3C at primary locus when alleic combinations at the secondary locus are homozygous or heterozygous. Differences were calculated by subtraction of the linolenic acid level obtained from the first allelic combination at the primary locus minus the linolenic acid level obtained from the second allelic combination (example: AACC to aaCC).

 
Soybean lines developed with a fan mutation could be enhanced by a further reduction in linolenic acid concentration. To test the ability of the GmFAD3C mutation to further reduce linolenic acid levels in a line containing a fan mutation, an independent cross was made between the line A5 (fan fan) (Rennie and Tanner, 1991) and 2721. The line A5 was previously shown to have a deletion encompassing the GmFAD3A gene (Bilyeu et al., 2003; Byrum et al., 1997). Sixty-two F2 progeny were analyzed for linolenic acid phenotype and genotype. The F2 seeds were produced under the previously described growth conditions and chipped for fatty acid analysis before germination and genotyping.

As expected for segregation of different mutant alleles at GmFAD3A, but both mutant and wild-type alleles at GmFAD3C, the overall range of linolenic acid levels was low (25–52 g kg–1 oil). For GmFAD3A, our assay was only able to distinguish two genotype classes: a class with the deletion of both copies of GmFAD3A and a class that was either heterozygous or homozygous for the CX1512-44-derived GmFAD3A allele. We assumed the deletion of GmFAD3A and the CX1512-44-derived mutant alleles were equivalent, and we could not find significant differences (P ≤ 0.05) in linolenic acid levels between lines belonging to the different classes (data not shown). Segregation of the mutant GmFAD3C gene did produce significant differences in linolenic acid levels, as shown in Table 2. The average difference in linolenic acid from CC to cc was 11 g kg–1 oil with heterozygous differences approximately half of that value.


View this table:
[in this window]
[in a new window]
 
Table 2. Mean difference in seed linolenic acid level for F2 progeny with allelic substitutions of wild-type (uppercase) and mutant (lowercase) alleles of GmFAD3C when GmFAD3A is homozygous or heterozygous for allelic deletion or mutant allele. Differences were calculated by subtraction of the mean linolenic acid level obtained from the GmFAD3C minus mean the linolenic acid level obtained from the GmFAD3A locus (example: aaCC to aacc).

 
To determine the variation in linolenic acid levels in whole seeds derived from lines with specific genotypes for the FAD3 genes, four selected homozygous F2 genotypes (aacc, aaCC, AAcc, and AACC) of the Williams 82 x 2721 cross were analyzed for fatty acid phenotype of the F3 seeds. For each genotype (except aaCC, see Materials and Methods), 10 F3 seeds produced under our defined growth conditions were individually crushed and analyzed for fatty acid profiles (Fig. 4). The association between the GmFAD3A and GmFAD3C genotype and the linolenic acid phenotype for the F3 seeds was consistent with the F2 analysis. The trend toward higher standard deviations as the linolenic acid levels increased was also apparent in the F3 analysis. The average linolenic acid level for the 30 aacc F3 seeds comprised of three sets of 10 seeds produced on separate F2 plants was 27.3 g kg–1 oil, and the standard deviation was 1.8 g kg–1 oil.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 4. Phenotype of selected F3 genotypes homozygous for different combinations of the GmFAD3A and GmFAD3C wild-type and mutant alleles. Seven lines were selected from genotyped F2 plants, representing all homozygous combinations of GmFAD3A and GmFAD3C. For all lines except the aaCC representative (n = 5), 10 independent F3 seeds were analyzed for linolenic acid. The bars represent the average of the F3 seeds derived from a single F2 plant. Error bars represent one standard deviation of the mean.

 
Another generation of seeds (F4) representing three independent aacc homozygous genotypes was produced in greenhouse conditions, and whole seeds were analyzed for fatty acids. We had less control of growth conditions in the greenhouse relative to the defined conditions obtained from growth chambers. The low linolenic acid phenotype was sustained in F4 seeds, with linolenic acid values ranging from 25 to 33 g kg–1 oil from individual F4 seeds with an overall average linolenic acid of 29 g kg–1 oil. In seeds derived from the cross between 2721 and Williams 82 that were homozygous for the GmFAD3A and GmFAD3C mutations, the low linolenic acid phenotype could be identified at the F2 generation and stably inherited.


    DISCUSSION
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Here we report the molecular genetic basis for the low linolenic seed trait in soybean line CX1512-44. Using a candidate gene approach, we identified mutations in two of the three soybean microsomal omega-3 fatty acid desaturase genes that associate with a greater than two thirds reduction in seed linolenic acid levels. A compensatory increase in linoleic acid was also associated with mutations in the FAD3 genes. While the splice-site mutation in GmFAD3A almost certainly abolishes the production of a functional enzyme, the biochemical repercussions of the mutation in GmFAD3C are less clear. Dissection of the contribution of the two genes GmFAD3A (Fan) and GmFAD3C revealed that the GmFAD3A mutation had a greater effect on linolenic acid level reduction than the GmFAD3C mutation (linolenic acid levels of 46 g kg–1 oil vs. 15 g kg–1 oil, respectively), consistent with repeated discovery of mutations at the fan locus (Wilcox and Cavins, 1985; Rennie and Tanner, 1991; Rahman et al., 1996). Smaller differences in linolenic acid levels would be much more difficult to detect in a phenotype-based screening program. Our results indicate a gradient of decreasing standard deviations for samples as the linolenic acid level decreases, which may increase the efficiency of phenotypic screening for additional mutations in lines with fan mutations (Takagi et al., 1999; Ross et al., 2000).

In most cases examined, the contribution to the decrease in linolenic acid level of the mutant allele in a heterozygote was midpoint between the wild-type and fully mutant genotype. This result would fit well with a model of independent additive enzyme function, where each GmFAD3 allele represents a proportion of the total potential microsomal omega-3 fatty acid enzyme activity. For Williams 82, each wild-type GmFAD3A allele would contribute 23 g linolenic acid kg–1 oil to the seed. Assuming the CX1512-44 GmFAD3C mutation results in elimination of the encoded enzymes' function, the Williams 82 wild-type GmFAD3C alleles contribute 6 g (Cc to CC) and 9 g (cc to Cc) linolenic acid kg–1 oil to the seed. Similarly, each A5 wild-type GmFAD3C allele contributes 5.5 g linolenic acid kg–1 to the seed. As part of a breeding strategy, incorporation of the GmFAD3C allele from CX1512-44 to soybean lines that have been previously developed with a fan mutation would be expected to decrease the linolenic acid concentration an additional 1 to 1.5% (10–15 g kg–1 oil), in most cases to about 3% (30 g kg–1 oil) linolenic acid, a reasonable target level. The remaining enzyme activity from GmFAD3B and the chloroplast-targeted omega-3 fatty acid desaturases could be responsible for producing the residual 3% seed linolenic acid level in segregating populations stabilized for the aacc genotype. Reductions of linolenic acid levels to 1% (10 g kg–1 oil) have been reported (Ross et al., 2000).

Understanding the molecular basis for the low linolenic acid trait enhances breeding in soybean. Because CX1512-44 contains a novel fan mutation in GmFAD3A and the first characterized mutation in GmFAD3C, breeders can utilize CX1512-44 or its derived lines to further decrease linolenic acid levels in lines containing a fan mutation only. In addition, the development of SNP markers specific to the two mutations should allow rapid incorporation of the mutant genes into elite soybean lines, particularly if a backcrossing strategy is adopted.


    ACKNOWLEDGMENTS
 
We are grateful for the excellent technical assistance provided by April Bailey (USDA/ARS) and Christine Cole (University of Missouri).


    NOTES
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Contribution of the Missouri Agric. Exp. Stn. Mention of a trademark, vendor, or proprietary product does not constitute a guarantee or warranty of the product by the USDA or the University of Missouri and does not imply its approval to the exclusion of other products or vendors that may also be suitable.

Received for publication October 28, 2004.


    REFERENCES
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 


Related articles in Crop Science:

THIS ISSUE IN CROP SCIENCE

Crop Science 2005 45: x. [Full Text]  



This article has been cited by other articles:


Home page
The Plant GenomeHome page
J. D. Gillman, V. R. Pantalone, and K. Bilyeu
The Low Phytic Acid Phenotype in Soybean Line CX1834 Is Due to Mutations in Two Homologs of the Maize Low Phytic Acid Gene
The Plant Genome, July 1, 2009; 2(2): 179 - 190.
[Abstract] [Full Text] [PDF]


Home page
Crop Sci.Home page
W. R. Fehr
Breeding for Modified Fatty Acid Composition in Soybean
Crop Sci., December 18, 2007; 47(Supplement_3): S-72 - S-87.
[Abstract] [Full Text] [PDF]


Home page
Crop Sci.Home page
G. E. Byfield and R. G. Upchurch
Effect of Temperature on Microsomal Omega-3 Linoleate Desaturase Gene Expression and Linolenic Acid Content in Developing Soybean Seeds
Crop Sci., November 7, 2007; 47(6): 2445 - 2452.
[Abstract] [Full Text] [PDF]


Home page
Crop Sci.Home page
A. S. Chappell and K. D. Bilyeu
The Low Linolenic Acid Soybean Line PI 361088B Contains a Novel GmFAD3A Mutation
Crop Sci., July 30, 2007; 47(4): 1705 - 1710.
[Abstract] [Full Text] [PDF]


Home page
Crop Sci.Home page
K. Bilyeu, L. Palavalli, D. A. Sleper, and P. Beuselinck
Molecular Genetic Resources for Development of 1% Linolenic Acid Soybeans
Crop Sci., July 25, 2006; 46(5): 1913 - 1918.
[Abstract] [Full Text] [PDF]


Home page
Crop Sci.Home page
P. R. Beuselinck, D. A. Sleper, and K. D. Bilyeu
An Assessment of Phenotype Selection for Linolenic Acid Using Genetic Markers
Crop Sci., February 24, 2006; 46(2): 747 - 750.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Related articles in Crop Science
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bilyeu, K.
Right arrow Articles by Beuselinck, P.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Bilyeu, K.
Right arrow Articles by Beuselinck, P.
Agricola
Right arrow Articles by Bilyeu, K.
Right arrow Articles by Beuselinck, P.
Related Collections
Right arrow Soybean
Right arrow Crop Physiology & Metabolism


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
The SCI Journals Agronomy Journal Vadose Zone Journal
Journal of Natural Resources
and Life Sciences Education
Soil Science Society of America Journal
Journal of Plant Registrations Journal of
Environmental Quality
The Plant Genome