Published in Crop Sci. 44:2206-2213 (2004).
© 2004 Crop Science Society of America
677 S. Segoe Rd., Madison, WI 53711 USA
GENOMICS, MOLECULAR GENETICS & BIOTECHNOLOGY
Engineering Higher Yield and Herbicide Resistance in Rice by Agrobacterium-Mediated Multiple Gene Transformation
M. X. Caoa,
J. Q. Huanga,*,
Z. M. Weia,
Q. H. Yaob,
C. Z. Wanc and
J. A. Luc
a National Lab. of Plant Molecular Genetics, Inst. of Plant Physiology and Ecology, Shanghai Inst. for Biological Sciences, Chinese Academy of Sciences, Shanghai 200032, China
b Agrobiotech Research Center, Shanghai Academy of Agricultural Sciences, Shanghai 201106, China
c Crop Breeding and Cultivation Research Institute, Shanghai Academy of Agricultural Sciences, Shanghai 201106, China
* Corresponding author (jqhuang{at}iris.sipp.ac.cn)
 |
ABSTRACT
|
|---|
The Vitreoscilla hemoglobin gene (VHb), trans-zeatin secretion gene (tzs), and the modified 5-enolpyruvylshikimate-3-phosphate synthase gene (EPSPS), as linked expression cassettes, were simultaneously introduced into immature embryos of the rice (Oryza sativa L.) cultivars Xiushui-11, Qiufeng, Youfeng, and Hanfeng by Agrobacterium tumefaciens. A total of 1153 transgenic lines composed of 4222 plants were obtained through selection for hygromycin (hyg) B resistance. Genomic polymerase chain reaction (PCR), southern and northern blotting analyses, and other relative tests showed that all transgenes had been integrated into the rice genome and expressed effectively. Approximately 90.2% of the transgenic lines harbored all the transgenes. Expression analysis revealed that all transgenes coexpressed stably in transgenic plants, and the frequency of coexpression was about 85%. Statistically significant increases were observed in plant height, panicle length, total grains per panicle, and filled grains per panicle in transgenic plant lines compared with the control. Our study demonstrates a possible way to introduce different transgenes as linked expression cassettes within a single vector into the plant genome. Moreover, this transgenic approach has great potential in developing new rice cultivars with increased productivity and enhanced tolerance to the herbicide glyphosate.
Abbreviations: AS, acetosyringone DIG, digoxigenin EPSPS, 5-enolpyruvylshikimate-3-phosphate synthase EPSPS, modified 5-enolpyruvylshikimate-3-phosphate synthase gene GUS, ß-D-glucuronidase hpt, hygromycin phosphotransferase gene hyg, hygromycin ipt, isopentanyl transferase gene MAR, matrix attachment region PCR, polymerase chain reaction RBCS, small subunit of ribulose-bisphosphate carboxylase SAR, scaffold attachment region SCC, standard saline citrate tzs, trans-zeatin secretion gene VHb, Vitreoscilla hemoglobin gene
 |
INTRODUCTION
|
|---|
PLANT GENETIC engineering often demands stable cotransformation of two or more transgenes. For example, to achieve resistance against a broader range of pathogens in plants, coexpression of transgenes encoding antimicrobial proteins with different biochemical targets is an attractive approach (Halpin et al., 1999). To produce a particular metabolite in plants, multiple transgenes that are involved in the biosynthetic pathway of the metabolite are cointroduced into plants (Ye et al., 2000). Other examples demonstrate the production of antibodies or other valuable biomolecules by coexpression of multiple genes involved (Peeters et al., 2001; Wilde et al., 2002). Multiple genes can be introduced into plants via several strategies, such as one-step transformation using a single vector containing all the transgenes (Slater et al., 1999), one-step transformation using multiple vectors (Campbell et al., 2000), sequential single-gene transformation steps, and separate transformation events (Bizily et al., 2000).
The obligate aerobic bacterium, Vitreoscilla, synthesizes elevated quantities of a homodimeric hemoglobin (VHb) under hypoxic growth conditions. Expression of VHb in heterologous hosts often enhances growth and product formation (Holmberg et al., 1997; Ramandeep et al., 2001). A role in facilitating oxygen transfer to the respiratory membranes is one explanation of its cellular function. Holmberg et al. (1997) reported that transgenic tobacco (Nicotiana tabacum L.) plants expressing VHb exhibited enhanced growth, on average 80 to 100% more dry weight after 35 d of growth compared with wild-type controls. Furthermore, germination time was reduced from 68 d for wild-type tobacco to 34 d, and the growth phase from germination to flowering was 35 d shorter for the VHb-expressing transgenes. Transgenic plants contained, on average, 30 to 40% more chlorophyll and 34% more nicotine than controls.
Two Ti plasmid genes, tzs and ipt, code for proteins with isopentanyl transferase (IPT) activity in vitro, and both genes are responsible for trans-zeatin secretion in A. tumefaciens (Heinemeyer et al., 1987). There are numerous examples of ipt expression in plants using a range of constitutive, tissue-specific, or inducible promoters (Ma et al., 2002; Mckenzie et al., 1998; Roeckel et al., 1998). The physiological effects of the resulting abnormally high cytokinin levels include stunted growth, adventitious shoot formation (loss of apical dominance), delayed senescence, and reduced root formation. The A. tumefaciens gene tzs, which is present on the nopaline Ti plasmid but is not transferred to plants, is homologous to ipt and has a similar function. Heat-induced expression of a hsp70-tzs construct in oilseed rape resulted in increased amounts of zeatin-type cytokinins with associated symptoms, including increased seed numbers per silique (Roeckel et al., 1998).
5-Enolpyruvylshikimate-3-phosphate synthase, which catalyzes the reversible addition of the enolpyruvyl moiety of phosphoenolpyruvate to shikimate 3-phosphate in the shikimate pathway, is located in some enteric bacteria and the plastids of higher plants. The wild-type enzyme protein, encoded by the aroA locus in E. coli, is inhibited by the broad-spectrum herbicide glyphosate, while a mutagenized strain of Salmonella typhimurium owes its glyphosate tolerance to a single amino acid substitution of P101S (a Proline to Serine amino substitution at the 101st codon of the protein) in the EPSPS encoded by a mutant aroA gene (Comai et al., 1983; Stalker et al., 1985). The mutant S. typhimurium aroA gene (modified EPSPS gene) was cloned and introduced into crop plants, and the transgenics produced the mutant EPSPS and were tolerant to glyphosate (Comai et al., 1985; Fillatti et al., 1987).
Here, we report the introduction into rice immature embryos of VHb, tzs, and the modified EPSPS gene as linked expression cassettes, each with a different promoter and a terminator, within a single vector via Agrobacterium transformation. Stable integration, expression, and inheritance of transgenes were confirmed by molecular and genetic analyses of the transformants and their progenies. Considering the importance of rice as a major crop, developing new cultivars with enhanced productivity and herbicide tolerance would undoubtedly have an enormous impact on global food production.
 |
MATERIALS AND METHODS
|
|---|
Construction of Plasmid for Transformation
The VHb gene was designed and synthesized using a successive PCR technique for optimal expression in plants (Genebank No. AF274976). Genomic DNA was isolated from a wild A. tumefaciens strain, and the tzs gene associated with trans-zeatin biosynthesis was amplified by PCR, cloned, and sequenced. In addition, the modified EPSPS gene was cloned and sequenced (Stalker et al., 1985). Three expression cassettes were constructed respectively. Nos + Omega enhancer was used for driving the expression of the synthetic VHb gene. The tzs gene was controlled by the pistil-specific STS14 promoter derived from potato (Eldik et al., 1996) for overexpression and tissue-specific expression. The modified EPSPS gene was driven by the CaMV35S + TMV (Tobacco mosaic virus) Omega leader sequence, linked with a chloroplast-targeting transit peptide sequence of RBCS (small subunit of ribulose-bisphosphate carboxylase) from Arabidopsis at the 5' region. These three cassettes were linked through constructing two intermediate vectors, pYP1203C and pYP1203D, derived from pCAMBIA1301. A chromosome matrix-attachment region SAR68 (Allen et al., 1996, Genebank No. U67919) from tobacco was inserted between the expression cassette of tzs and VHb. The resulting plasmid pYP1203E (21.7 kbp), carrying five tandem expression cassettes within the T-DNA region (Fig. 1)
, was then transferred into a disarmed Agrobacterium strain EHA105 via electroporation.

View larger version (7K):
[in this window]
[in a new window]
|
Fig. 1. Schematic representation of the T-DNA region in the pYP1203E plasmid. 5'NOS, 5'-untranslated promoter region of the Agrobacterium tumefaciens nopaline synthase gene. VHb, homodimeric hemoglobin gene; 3'rbcs, 3'-untranslated terminator region of the Arabidopsis rbcs gene; SAR68, chromosome matrix-attachment region (MAR) of tobacco; 5'STS14, the pistil-specific promoter derived from potato; tzs, trans-zeatin secretion gene; 3'nos, 3'-untranslated terminator region of the nopaline synthase gene; EPSPS, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) gene; RBCS, the chloroplast-targeting transit peptide RBCS from Arabidopsis at the 5' region of the EPSPS expression cassette; 5'35S, CaMV35S promoter; gus (intron), ß-glucuronidase gene with an intron; 5'D35S, double CaMV35S promoter; hpt, hygromycin phosphotransferase gene; LB, left border; RB, right border; BglII cut the plasmid DNA at a single site between 5'35S and GUS gene sequence.
|
|
Materials for Transformation
Four elite japonica rice cultivars, Xiushui-11, Qiufeng, Youfeng, and Hanfeng, were used. Media used for tissue culture and transformation are listed in Table 1. Immature seeds were first surface-sterilized with 75% ethanol for 1 min, and then sterilized with 2% sodium hypochlorite for 15 min, and further washed several times with sterilized deionized water. The immature embryos were dissected aseptically and cultured on solid N6D2 medium. The cultures were incubated in the dark at 25 ± 1°C for 4 to 5 d. The compact calli (12 mm in diameter) derived from the scutella were separated with a scalpel and used for transformation.
Transformation and Production of Transgenic Plants
Rice calli were subjected to Agrobacterium-mediated transformation using a modified protocol of Hiei et al. (1994). EHA105 (pYP1203E) was grown to an OD600 of 0.8 (OD is optical density) in AAD1AS (Table 1). The rice calli were immersed in the bacterial suspension for 20 min and then transferred on a piece of filter paper placed on the coculture medium N6D2AS (Table 1), and incubated at 25 ± 1°C in darkness for 3 d. One-microliter liquid medium (AAD1AS) was dripped onto the surface of the filter paper (Huang et al., 2000). After cocultivation, the calli were rinsed thoroughly with 500 mg L1 cefotaxime (Dingguo, Beijing) in 0.1 M sterile mannitol solution. The inoculated calli were first placed onto N6D2CH25 (Table 1) for 2 wk and then transferred onto N6D2CH50 (Table 1) for further selection for 2 to 3 wk. Colonies of cells that had proliferated on the selection media were transferred onto a regeneration medium, RE1CH50 (Table 1), and inoculated at 26 ± 2°C under a 16-h photoperiod for shoot development. Regenerated shoots were further transferred to RE2CH50 (Table 1) for full plantlet formation and then rooted on 1/2MSNH50 (Table 1). Rooted plantlets were transferred to soil in pots and grown to maturity in a greenhouse (28°C day/25°C night) with a supplemental photoperiod of 10 h (photo flux density of 280 µmol m2 s1).
Polymerase Chain Reaction Analysis
Genomic DNA was isolated from rice leaves of transgenic lines according to procedures described by Murray and Thompson (1980). Each PCR reaction mixture contained 1 µg genomic DNA, 5 µL 10 x Taq DNA polymerase buffer, 200 µM of each deoxyribonucleotide (dNTP), 25 pmol of each primer, and 0.5 U Taq DNA polymerase (Sangon, Shanghai, China) in a total volume of 50 µL. The reaction mixture was overlaid with 50 µL of mineral oil. The following primers were used:
- 5'CACCCAAGCGTGGTGATGTGGAG3',
- 5'TCCCTGCTGCGGTTTTTCACCGAAG3',
- 5'GTAGATCTGAGGGTAAATTTCTAG3',
- 5'ATTTCACGTTCTACAGGACGGACG3',
- 5'CCTGACGTTACAACCCATCGCTCG3',
- 5'GTCGATATAAGGTTTAGAAACCAGATC3'.
Primers 1 and 2 hybridize to the VHb gene sequence to produce a 600-bp product, primers 3 and 4 hybridize to the tzs gene sequence to produce a 240-bp product, and primers 5 and 6 hybridize to the EPSPS gene sequence to produce a 600-bp product. The PCR conditions for primer pairs 1/2 and 3/4 were genomic DNA denaturation at 94°C for 5 min, followed by 30 amplification cycles (1 min 30 s at 94°C, 1 min at 58°C, and 1 min at 72°C), and then elongation at 72°C for 10 min using a DNA Thermal Cycle480 (Perkin-Elmer Corp., Norwalk, CT). For primer pair 5/6, the same PCR conditions were used except that the annealing temperature was changed to 55°C. All PCR products (amplified from the coding region of their respective genes) were also used as probes for the southern and northern blot analyses described below.
Southern Blot Analysis
Southern blot analysis was performed on T1 progeny from selected hyg-tolerant and PCR-positive events to confirm that the introduced transgenes were stably integrated into the rice genome. Leaves from nontransformed control plants and representative T1 plants of seven lines were ground in liquid N by using a mortar and pestle. Rice genomic DNA was isolated by a CTAB (cetyltrimethylammonium bromide) method modified from Murray and Thompson (1980). Fifteen micrograms of genomic DNA was digested overnight with BglII and electrophoresed on 0.8% agarose gels. Gels were blotted by capillary transfer with 20 x SSC (standard saline citrate) on Hybond N+ nylon membrane (Amersham Pharmacia, UK). The three PCR products mentioned above were each labeled with DIG-High Prime (digoxigenin; Roche Applied Science, Penzberg, Germany). The DNA probe preparation, hybridization, washing, and detection were performed according to the instruction manual (Roche Applied Science, 2003).
Northern Blot Analysis
For northern blot analysis, total RNA was isolated from pistils (stigma together with style, within 48 h before or after anthesis) and developing kernels (515 d after flowering) of representative T1 plants with a total RNA isolation kit (RNAex Reagent and Systems, Watson, Shanghai, China) using the manufacturer's instructions. The RNAs were quantified spectrophotometrically by absorbance at 260 nm. Twenty micrograms of RNA per sample were electrophoresed on formaldehyde 1.0% (w/v) agarose gels. The RNA was blotted by capillary transfer with 20 x SSC on Hybond N+ nylon membrane (Amersham Pharmacia, UK). The DIG-labeled DNA probes were the same as those used for southern blotting, and the hybridization, washing, and detection were performed according to the instruction manual (Roche Applied Science, 2003).
Hygromycin Selection and ß-D-Glucuronidase Screening
Selfed seeds of the transformants were sown on solidified MS0H70 (Table 1) and cultured at 25 ± 1°C. Hygromycin resistance was scored 7 to 10 d after sowing by determining segregation of the selectable marker gene in T1 progeny. Resistant seeds germinated normally on the selection medium, unlike susceptible seeds.
Segments of rice tissues were incubated in a buffer containing 50 mM phosphate, 50 mM disodium EDTA, 0.5 mM each of potassium ferro- and ferri-cyanide, 0.1% (w/v) X-gluc (5-bromo-4-chloro-3-indolyl-ß-D-glucuronide), and 0.1% (w/v) Triton X-100, as described by Jefferson (1987) except that 20% (w/v) methanol was added to eliminate the endogenous ß-D-glucuronidase (GUS) activity, at 37°C in the dark for 2 h to overnight. All green tissues were placed in 70% alcohol to remove chlorophyll for visualization.
Herbicide Tolerance
To test for herbicide tolerance, a water solution of 5.0 mM glyphosate and 0.1% (v/v) Tween 20 (polyoxyethylene sorbitan monolaurate) was placed on both sides of the leaves of T0 and T1 plants when they were approximately 61 cm tall. Alternatively, plantlets at the three-leaf stage were sprayed with 0.036 L ha1 glyphosate formulation (360 g a.i. L1) with the equivalent of 13 g ha1 glyphosate. All the plantlets following glyphosate treatment were scored for tolerance after 2 wk.
Segregation Analysis for Hygromycin Phosphotransferase Gene and ß-D-Glucuronidase Screening
A half-seed test was performed to determine the segregation pattern of hpt (hygromycin phosphotransferase gene) and gus in T1 progeny. Seeds from T0 plants (self-pollinated) were cut into two halves, the half containing the embryo was surface-sterilized and germinated on MS0H70 medium containing 70 mg L1 hyg, and the other half was histochemically stained for GUS expression. Data were analyzed by chi-square tests for goodness-of-fit to the expected ratios.
Analysis of Growth Performance and Productivity
To assess the effects of VHb and tzs expression on the growth performance and productivity of transgenic rice, field experiments were conducted at the Crop Breeding and Cultivation Research Institute, Shanghai (31°14'N, 121°29'E, 4 m altitude). Panicle initiation date, complete heading date, ripening date, plant height, panicle length, total grains per panicle, filled grains per panicle, seed-setting rate, and 1000-grain weight were measured on populations of transgenic plants, which were hyg resistant, glyphosate tolerant, and morphologically identical. The data were statistically analyzed and probability values were estimated using the Student's t test.
 |
RESULTS
|
|---|
Production of Phenotypically Normal and Fertile Transgenic Rice Plants
A total of 1153 putative transgenic lines, including 553 transformants of Qiufeng, 449 of Xiushui-11, 109 of Hanfeng, and 42 of Youfeng, were regenerated. Transformation efficiency ranged from 70.7% (Qiufeng) to 20.4% (Youfeng), with an average of 47.1% (Table 2). Most of the independent primary transformants (T0 generation) showed a normal phenotype and were completely fertile (Fig. 2AD) .

View larger version (153K):
[in this window]
[in a new window]
|
Fig. 2. Rice transformation mediated by Agrobaterium tumefaciens EHA105/pYP1203E and the results of GUS (ß-D-glucuronidase) histochemical analysis and herbicide-resistance test of transgenic rice plants. (A) Regenerated resistant shoots on RE2CH50 medium. (B) Regenerated shoots and roots on 1/2MSNH50 medium (Left is the nontransformed control shoots). (C) Transgenic plants carrying the five transgenes putatively growing in soil in the greenhouse. (D) T1 progeny of transgenic Qiufeng carrying the five transgenes. (E) The roots and leaf of transgenic rice plants and the hygromycin-resistent calli (right) compared with the nontransformed control (left). (F) The leaves of transgenic rice plants (right) and the nontransformed control (left) after daubing with 5.0 mM glyphosate solution. (G) Transgenic plants (right) and the nontransformed control (left) after spraying with the equivalent of 13 g ha1 glyphosate.
|
|
Stable Integration of Transgenes
The integration of the three transgenes of interest, VHb, tzs, and the modified EPSPS gene, into the rice genome was verified by PCR and southern blot analysis. One hundred thirteen transgenic lines (43 transformants of Qiufeng, 29 of Xiushui-11, 26 of Hanfeng, and 15 of Youfeng) were selected for PCR assay (Table 3 and Fig. 3)
. Among the 113 independent transformants (Hygr), 102 (90.2%) carried all three genes. A total of 72 T1 plants from six independent lines were used in southern blot analysis. Results confirmed the integration and inheritance of the foreign genes in the rice genome (Fig. 4)
. The T1 plants, including two representative lines of Xiushui-11 (X-1-1 and X-2-9), two lines of Qiufeng (Q-1-5 and Q-2-1), one line of Hanfeng (H-1-1), and one line of Youfeng (Y-1-1), contain a low copy number (13 copies) of the transgenes. The cointegration frequency (90.2%) and the southern blot analysis provide evidence that the three transgenes of interest were integrated as linked sequences at the same locus.
View this table:
[in this window]
[in a new window]
|
Table 3. The cointegration analysis of the transgenes in T0 plants (hygromycin-resistant) by polymerase chain reaction assay.
|
|

View larger version (68K):
[in this window]
[in a new window]
|
Fig. 3. Polymerase chain reaction analysis of VHb (Vitreoscilla hemoglobin gene), tzs (trans-zeatin secretion gene), and EPSPS (5-enolpyruvylshikimate-3-phosphate synthase) in T0 rice plant. Lanes: M, molecular weight marker (A) and (C) DL2000, (B) X174 HaeIII digest; P, positive control (amplified fragments from plasmid pYP1203E); C, a nontransformed control plant; X-1 and X-2, putative T0 plants of Xiushui-11; Q-1 and 2, putative T0 plants of Qiufeng; H-1, putative T0 plants of Hanfeng; Y-1, putative T0 plants of Youfeng.
|
|

View larger version (96K):
[in this window]
[in a new window]
|
Fig. 4. Southern blot analysis of T1 transgenic rice plants. Lane: P, 5 ng plasmid pYP1203E DNA cut by BglII at a single site was loaded as a positive control; C, a nontransformed control plant; X-1-1, X-2-9, Q-1-5, Q-2-1, H-1-1, and Y-1-1, representative T1 transgenic plants from their T0 progenies respectively (Plant genomic DNA digested with BglII. X stands for Xiushui-11, Q for Qiufeng, H for Hanfeng, and Y for Youfeng). The three polymerase chain reaction products were used as probes and labeled with DIG-Prime (digoxigenin; Roche Applied Science, Penzberg, Germany). The same southern filter was rehybridized with different probes. (A) VHb, Vitreoscilla hemoglobin gene; (B) tzs, trans-zeatin secretion gene; (C) EPSPS, 5-enolpyruvylshikimate-3-phosphate synthase gene.
|
|
Expression of Transgenes
The gus gene was highly expressed in the hyg-resistant calli and in the transgenic rice plants (Fig. 2E). The half-seed test showed that T1 progeny from eight independent transformants, X4, X5, Q3, Q11, H13, H16, Y3, and Y8, fit a 3:1 ratio or a 15:1 ratio for hpt and gus genes (Table 4), indicating that the two transgenes were linked tightly at one or possibly two integration sites.
Leaves of putative T0 plants remained green, while those of control plants turned yellow following glyphosate treatment (Fig. 2F). When sprayed with glyphosate, nontransformed plants were killed at the spray rate of 13 g ha1 glyphosate, while all putative T0 plants that regenerated on hyg selection medium exhibited tolerance to glyphosate (Fig. 2G). The tolerance to susceptible ratio of four independent events (Q6, X6, H6, and Y6) fit a 3:1 ratio, confirming that the modified EPSPS gene was inherited in a simple Mendelian fashion (Table 5).
Fifty-five T1 plants (each from an independent transgenic event) that were hyg resistant were analyzed for expression of VHb and tzs by northern blot assays (Fig. 5)
. Four T1 transgenic rice lines (X-1-1, Q-2-5, H-1-1, and Y-1-1) expressed VHb, while no expression was found in the nontransformed control plants (Fig. 5A). We confirmed that tzs under the pistil-specific promoter STS14 was expressed highly in the pistil of transgenic plants, while no expression was observed in the seed of the transgenic plants and the nontransformed control (Fig. 5B).

View larger version (95K):
[in this window]
[in a new window]
|
Fig. 5. Northern analysis of the expression of VHb (Vitreoscilla hemoglobin gene) and tzs (trans-zeatin secretion gene) in T1 plants. Lanes: X-1-1(k), Q-2-1(k), H-1-1(k), and Y-1-1(k) in (A) and (B) were loaded with 20 µg total RNA from kernels of T1 plants; Lanes: X-1-1(p), Q-2-1(p), and H-1-1(p) in (B) were loaded with 20 µg total RNA from pistils of T1 plants; Lanes: C(k) and C(p) were loaded with 20 µg total RNA from kernels and pistils of nontransformed control respectively. X stands for Xiushui-11, Q for Qiufeng, H for Hanfeng, and Y for Youfeng.
|
|
Twenty hyg-resistant and GUS-positive T1 plants (each from an independent transgenic event) were selected to assay for the coexpression of all transgenes. Out of the 20 plants, 17 (85%) expressed all five transgenes. However, X-6-2 did not express tzs; H-5-9 lacked expression of VHb; and Q-3-4 did not express VHb, tzs, or EPSPS.
Enhanced Shoot Growth and Seed Productivity
On the basis of the cointegration and coexpression of the transgenes, most transgenic families were considered to be useful in a breeding program. Field experiments were conducted to measure various parameters (Table 6). Plant height, panicle length, the number of total grains per panicle, and the number of filled grains per panicle were significantly increased in T2 lines of 23-1 and 63-50 (Qiufeng); 18-34 (Xiushui-11); 20-5 (Hanfeng); and 1-3 and 25-18 (Youfeng), as compared with the nontransformed counterparts (Table 6). There were no obvious differences in seed-setting rate and 1000-grain weight between control and most transgenic lines except 23-1 (Qiufeng) and 25-18 (Youfeng), where a significant increase was observed in 1000-grain weight, as compared with the control (Table 6). The number of total grains per panicle, and the number of filled grain per panicle significantly increased in line 19-7 (Xiushui-11) compared with the control, although plant height, panicle length, seed-setting rate, and 1000-grain weight were lower than the control (Table 6). Finally, no significant differences in the parameters studied were found between line 54-13 (Qiufeng) and the control (Table 6). Moreover, no significant differences in the growth phases from transplanting to panicle initiation and then to complete heading and ripening were found in any of the lines studied (data not shown).
 |
DISCUSSION
|
|---|
Using Agrobacterium-mediated gene transfer, a large segment of DNA can be delivered to plants (Hamilton et al., 1996), and linking multiple genes in a single plasmid is technically possible. In our study, we constructed the binary vector pYP1203E (21.7 kbp), which harbored three genes of interest, in addition to a selectable marker gene and a reporter gene, as linked expression cassettes in the T-DNA region. The advantages of this method are that the different transgenes are frequently inserted into the same locus, and that a single selectable marker is used. It has been observed that the presence of multiple copies of the same promoter within a transgenic plant often results in transcriptional silencing of the transgenes (Matzke and Matzke, 1998). To avoid transcriptional silencing of the transgenes, we used different promoters for each of the expression cassettes. Moreover, matrix attachment regions (MARs) or scaffold attachment regions (SARs) have been reported to increase overall levels of expression and decrease variability of expression (Allen et al., 1996, 2000; Spiker and Thompson, 1996; Ulker et al., 1999). Here, SAR68, a chromosome MAR of tobacco (SAR68) was used in our vector construction (Fig. 1) to enhance the expression of the transgenes. Our results confirmed that the vector transferred the transgenes into the plant's genome efficiently and ensured their successful expression.
Enhancing crop productivity is a fundamental objective of agriculture. Oxygen, as a limiting factor in plant productivity, along with other environmental factors such as sunlight, water, mineral nutrients, and carbon dioxide, can place constrains on plant metabolism. Research has focused on optimizing the plant's abilities to effectively utilize these resources. Holmberg et al. (1997) generated tobacco plants that synthesize the VHb hemoglobin and demonstrated that these transgenic plants had increased productivity compared with their nontransformed counterparts. The mechanism by which the VHb functions in the tobacco system is thought to be through a combination of increased availability of O2 as a substrate for cellular metabolism and by increased O2 leading to higher levels of ATP available for powering cellular metabolism. It is also possible that the hemoglobin scavenges free O2 and its radicals, thus protecting the cell from these harmful molecules.
Cytokinins are involved in aspects of plant growth and development. The ipt gene or tzs gene from the plant pathogenic bacterium A. tumefaciens have been introduced into plants to enhance the endogenous cytokinin content in tissues. In combination with an increase in cytokinin level, the transgenic plants often have higher growth rates and enhanced productivity.
In our study, rice plants transformed with both VHb and tzs displayed statistically significant increases in plant height and panicle length compared with the nontransformed controls. The results are consistent with findings of Holmberg et al. (1997) in that transgenic tobacco plants expressing VHb exhibited enhanced growth. We also found increases in the numbers of total grains per panicle and filled grains per panicle, and these results are consistent with findings of Roeckel et al. (1998) in that transgenic oilseed rape expressing tzs showed increased seed numbers per silique. Unexpected modifications of some agronomic traits were found. For example, no significant differences in any of the parameters studied were found between line 54-13 (Qiufeng) and the control. Additionally, seed-setting rate and 1000-grain weight were not modified in several of the transgenic plants. These phenotypic alterations may be further explained by detailed analysis of different factors known to affect growth, including endogenous and environmental factors.
Because weeds are a great menace in rice plantations, and herbicides are considered the most efficient way to control weeds in rice, we sought to produce glyphosate-tolerant rice. In our study, the modified EPSPS gene was expressed in rice and the product protein was targeted to the rice chloroplast by a chloroplast-targeting transit peptide sequence from RBCS. The transgenic rice plants had high levels of tolerance to glyphosate when sprayed at the rate of 5.0 mM or 13 g ha1.
In summary, our study showed that multiple foreign genes of agronomic importance, as linked expression cassettes within a single vector, can be introduced into the plant genome through Agrobacterium-mediated transformation. The transgenic rice plants displayed increased productivity and enhanced tolerance to the herbicide glyphosate, although more detailed studies involving prolonged expression and inheritance of the transgenes, along with traditional breeding progress, must be done to obtain a new plant type with increased yield potential.
 |
ACKNOWLEDGMENTS
|
|---|
The authors thank Dr. H.Q. Yang, H.W. Xue, H.L. An, R. Xie, and Y.Z. Wang for technical assistance and encouragement. The research was supported by grants from the National High Science and Technology Program of China (863-2001AA212251).
Received for publication October 8, 2003.
 |
REFERENCES
|
|---|
- Allen, G.C., G. Hall, S.M.W. Newman, S. Spiker, A.K. Weissinger, and W.F. Thompson. 1996. High-level transgene expression in plant cells: Effects of a strong scaffold attachment region from tobacco. Plant Cell 8:899913.[Abstract]
- Allen, G.C., S. Spiker, and W.F. Thompson. 2000. Use of matrix attachment regions (MARs) to minimize transgene silencing. Plant Mol. Biol. 43:361376.[Web of Science][Medline]
- Bizily, S.P., C.L. Rugh, and R.B. Meagher. 2000. Phytodetoxification of hazardous organomercurials by genetically engineered plants. Nat. Biotechnol. 18:213217.[Web of Science][Medline]
- Campbell, B.T., P.S. Baenziger, A. Mitra, S. Sato, and T. Clemente. 2000. Inheritance of multiple transgenes in wheat. Crop Sci. 40:11331141.[Abstract/Free Full Text]
- Comai, L., D. Facciotti, W.R. Hiatt, G. Thompson, R.E. Rose, and D.M. Stalker. 1985. Expression in plants of a mutant aroA gene from Salmonella typhimurium confers tolerance to glyphosate. Nature (London) 317:741744.
- Comai, L., L. Sen, and D.M. Stalker. 1983. An altered aroA gene product confers resistance to the herbicide glyphosate. Science (Washington, DC) 221:370371.[Abstract/Free Full Text]
- Eldik, G.J.V., M. Wingens, R.K. Ruiter, M.M.A.V. Herpen, J.A.M. Schtauwen, and G.J. Wullems. 1996. Molecular analysis of a pistil-specific gene expressed in the stigma and style cortex of Solanum tuberosum. Plant Mol. Biol. 30:171176.[Web of Science][Medline]
- Fillatti, J.A.J., J. Kiser, R. Rose, and L. Comia. 1987. Efficient transfer of glyphosate tolerance gene into tomato using a binary Agrobacterium tumefaciens vector. Bio/technology 5:726730.
- Halpin, C., S.E. Cooke, A. Barakate, A.E.I. Amrani, and M.D. Ryan. 1999. Self-processing 2A-polyproteins: A system for coordinate expression of multiple proteins in transgenic plants. Plant J. 17:453459.[Web of Science][Medline]
- Hamilton, C.M., A. Frary, C. Lewis, and S.D. Tanksley. 1996. Stable transfer of intact high weight DNA into plant chromosomes. Proc. Natl. Acad. Sci. USA 93:99759979.[Abstract/Free Full Text]
- Heinemeyer, W., I. Buchmann, D.W. Tonge, J.D. Windass, J. Alt-Moerbe, E.W. Weiler, T. Botz, and J. Schroder. 1987. Two Agrobacterium tumefaciens genes for cytokinin biosynthesis: Ti plasmid-coded isopentenyltransferases adapted for function in prokaryotic or eukaryotic cells. Mol. Gen. Genet. 210:156164.[Web of Science]
- Hiei, Y., S. Ohta, T. Komari, and T. Kumashiro. 1994. Efficient transformation of rice mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant J. 6:271282.[Web of Science][Medline]
- Holmberg, N., G. Lilius, J.E. Bailey, and L. Buelow. 1997. Transgenic tobacco expressing Vitreoscilla hemoglobin exhibits enhanced growth and altered metabolite production. Nat. Biotechnol. 15:244247.[Web of Science][Medline]
- Huang, J.Q., Z.M. Wei, H.L. An, S.P. Xu, and B. Zhang. 2000. Efficient transformation and regeneration of rice mediated by Agrobacterium. Acta. Bot. Sin. 42:11721178.
- Jefferson, R.A. 1987. Assay chimeric genes in plants: The GUS gene fusion system. Plant Mol. Biol. Rep. 5:387405.
- Ma, Q.H., Z.B. Lin, and D.Z. Fu. 2002. Increased seed cytokinin levels in transgenic tobacco influence embryo and seeding development. Funct. Plant Biol. 29:11071113.
- Matzke, A.J.M., and M.A. Matzke. 1998. Position effects and epi-genetic silencing of plant genes. Curr. Opin. Plant Biol. 1:142148.[Web of Science][Medline]
- Mckenzie, M.J., V. Mett, P.H.S. Reynolda, and P.E. Jameson. 1998. Controlled cytokinin production in transgenic tobacco using a copper-inducible promoter. Plant Physiol. 116:969977.[Abstract/Free Full Text]
- Murashige, T., and F. Skoog. 1962. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 15:473497.
- Murray, M.G., and W.F. Thompson. 1980. Rapid isolation of high molecular weight plant DNA. Nucl. Acid Res. 8:43214325.[Abstract/Free Full Text]
- Peeters, K., C. Wilde, and A. Depicker. 2001. Highly efficient targeting and accumulation of a Fab fragment within the secretory pathway and apoplast of Arabidopsis thaliana. Eur. J. Biochem. 268:42514260.[Web of Science][Medline]
- Ramandeep, K.W. Hwang, M. Raje, K.J. Kin, B.C. Stark, K.L. Dikshi, and D.A. Webster. 2001. Vitreoscilla Hemoglobin: Intracellular localization and binding to membranes. J. Biol. Chem. 276:2478124789.[Abstract/Free Full Text]
- Roche Applied Science. 2003. DIG-High Prime DNA Labeling and Detection Starter Kit II [Online]. Available at http://www.roche-applied-science.com/pack-insert/1585614a.pdf [verified 11 June 2004]. Roche Applied Science, Penzberg, Germany.
- Roeckel, P., T. Oancia, and J.R. Drevet. 1998. Phenotypic alterations and component analysis of seed yield in transgenic Brassica napus plants expressing the tzs gene. Physiol. Plant. 102:243249.
- Slater, S., T.A. Mitsky, K.L. Houmiel, M. Hao, S.E. Reiser, N.B. Taylor, M. Tran, H.E. Valentin, D.J. Rodriguez, D.A. Stone, S.R. Padgette, G. Kishore, and K.J. Gruys. 1999. Metabolic engineering of Arabidopsis and Brassica for poly(3-hydroxybutyrate-co-3-hydroxyvalerate) copolymer production. Nat. Biotechnol. 17:10111016.[Web of Science][Medline]
- Spiker, S., and W.F. Thompson. 1996. Nuclear Matrix attachment regions and transgene expression in plants. Plant Physiol. 110:1521.[Web of Science][Medline]
- Stalker, D.M., W.R. Hiatt, and L. Comai. 1985. A single amino acid substitution in the enzyme 5-endopyruvyshikimate-3-phosphate synthase confers resistance to the herbicide glyphosate. J. Biol. Chem. 260:47244728.[Abstract/Free Full Text]
- Toriyama, K., and K. Hinata. 1985. Cell suspension and protoplast culture in rice. Plant Sci. 41:179183.
- Ulker, B., G.C. Allen, W.F. Thompson, S. Spiker, and A.K. Weissinger. 1999. A tobacco matrix attachment region reduces the loss of transgene expression in the progeny of transgenic tobacco plants. Plant J. 18:253264.[Web of Science]
- Wilde, C.D., K. Peeters, A. Jacobs, I. Peck, and A. Depicker. 2002. Expression of antibodies and Fab fragments in transgenic potato plants: A case study for bulk production in crop plants. Mol. Breed. 9:271282.
- Ye, X.D., A.B. Salim, K. Andreas, J. Zhang, L.P. Lucca, P. Beyer, and I. Potrykus. 2000. Engineering the provitamin A (beta-carotene) biosynthetic pathway into (carotenoid-free) rice endosperm. Science (Washington, DC) 287:303305.[Abstract/Free Full Text]
Related articles in Crop Science:
- THIS ISSUE IN CROP SCIENCE
Crop Science 2004 44: 1889-1892.
[Full Text]
This article has been cited by other articles:

|
 |

|
 |
 
S. Jokipii-Lukkari, A. D. Frey, P. T. Kallio, and H. Haggman
Intrinsic non-symbiotic and truncated haemoglobins and heterologous Vitreoscilla haemoglobin expression in plants
J. Exp. Bot.,
February 1, 2009;
60(2):
409 - 422.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Jokipii, H. Haggman, G. Brader, P. T. Kallio, and K. Niemi
Endogenous PttHb1 and PttTrHb, and heterologous Vitreoscilla vhb haemoglobin gene expression in hybrid aspen roots with ectomycorrhizal interaction
J. Exp. Bot.,
June 1, 2008;
59(9):
2449 - 2459.
[Abstract]
[Full Text]
[PDF]
|
 |
|