Crop Science
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (15)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sato, S.
Right arrow Articles by Clemente, T.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Sato, S.
Right arrow Articles by Clemente, T.
Agricola
Right arrow Articles by Sato, S.
Right arrow Articles by Clemente, T.
Related Collections
Right arrow Soybean
Right arrow Cell Biology & Molecular Genetics
Published in Crop Sci. 44:646-652 (2004).
© 2004 Crop Science Society of America
677 S. Segoe Rd., Madison, WI 53711 USA

GENOMICS, MOLECULAR GENETICS & BIOTECHNOLOGY

Production of {gamma}-Linolenic Acid and Stearidonic Acid in Seeds of Marker-Free Transgenic Soybean1

Shirley Sato2,a, Aiqiu Xing2,b, Xingguo Yec, Bruce Schweigerd, Anthony Kinneyd, George Graefc and Tom Clemente*,a

a Plant Science Initiative, Univ. of Nebraska, Lincoln, NE 68588
b Stine-Haskell Research Center, DuPont Agricultural Products, Newark, DE 19714
c Dep. of Agronomy and Horticulture, Univ. of Nebraska, Lincoln, NE 68583
d DuPont Exp. Stn., Wilmington, DE 19880

* Corresponding author (tclemente1{at}unl.edu)


   ABSTRACT
TOP
 NOTES
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Through a single desaturation step, the Borago officinalis L. {Delta}6 desaturase can convert linoleic acid and {alpha}-linolenic acid to {gamma}-linolenic acid (GLA) and stearidonic acid (STA), respectively. Both GLA and STA are of interest to the pharmaceutical and nutraceutical industries. Production of these fatty acids is costly. One potential strategy to reduce production cost would be to generate them in a major oilseed crop. To this end, a cDNA of the B. officinalis {Delta}6-desaturase gene was cloned downstream of the embryo-specific promoter ß-conglycinin. The resultant cassette was assembled into a two T-DNA binary vector, in which the second T-DNA element harbored a selectable marker cassette. The final plasmid was subsequently used to transform soybean [Glycine max (L.) Merr.]. The simultaneous delivery of two T-DNA elements was used as a strategy to derive soybean progeny transgenic for the {Delta}6 desaturase T-DNA and free of the marker gene T-DNA. Twenty-nine transgenic soybean lines were recovered that harbored both T-DNA elements, of which 17 produced GLA and STA in the seed storage lipids. Average GLA levels ranged from 3.4 up to 28.7%, while STA levels varied from just under 0.6 to 4.2% in the T1 generation. Among the 17 lines that produced GLA and STA, four lines were identified that were free of the selectable marker T-DNA element.

Abbreviations: GLA, {gamma}-linolenic acid • HS, herbicide sensitive • HT, herbicide tolerant • RT-PCR, reverse transcriptase-polymerase chain reaction • STA, stearidonic acid


   INTRODUCTION
TOP
 NOTES
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
HUNDREDS OF fatty acid species have been identified in the plant kingdom and many of them have important commercial applications. Most of these fatty acids are only available from a relatively few plant species, in which cost-effective production is difficult. Two examples of high-value fatty acids are GLA and STA. {gamma}-Linolenic acid has been used as a general nutraceutical (Horrobin, 1990) and for pharmacological applications in the treatment of skin conditions such as eczema. In addition, studies have revealed the fatty acid to possess some antiviral and anticancer properties (Horrobin, 1990; Gill and Valivety, 1997). Stearidonic acid, like GLA, is also of interest to both the pharmaceutical and nutraceutical industries (Griffiths et al., 1996). Commercial sources for GLA and STA are herbal oils derived from evening primrose (Oenothera biennis L.), borage, and black currents (Ribes nigrum L.) (Goffman and Galletti, 2001). The yield potential of these herbs is rather limited and levels of GLA and STA in the seed storage lipids constitute <16 and 5%, respectively.

In plants, GLA is produced by the desaturation of linoleic acid via a {Delta}6 desaturase (Sayanova et al., 1997). A cDNA clone of a {Delta}6 desaturase from borage expressed in tobacco was capable of generating both GLA and STA in the transgenic plants at 12.9 and 8.5%, respectively, in young leaves (Sayanova et al., 1997). Accumulation of the novel fatty acids in the transgenic tobacco lines varied across tissue, with the highest levels of 27.2% GLA and 8.7% STA being observed in stem tissue (Sayanova et al., 1999). Introduction of a fungal (Mortierella alpina Peyronel) {Delta}6 desaturase into canola (Brassica napus L.) resulted in accumulation of GLA in the seed to approximately 13%, while dual expression of the fungal {Delta}12- and {Delta}6-desaturase genes resulted in elevated levels of GLA in seeds, 43%, and production of STA levels of {approx}2% (Liu et al., 2001). The combination of {Delta}12- and {Delta}6-desaturase genes was required to enhance GLA levels in canola since the predominate fatty acid in B. napus seed is oleic. Expression of the {Delta}12 desaturase would shift the oleic acid pool to linoleic that, in turn, would be used as a substrate for the {Delta}6 desaturase. On the other hand, soybean seed storage lipids contain linoleic acid and {alpha}-linolenic acid at levels of {approx}55 and 10%, respectively. Hence, this major oilseed crop is the ideal target for cost-effective production of the two high-value fatty acids, GLA and STA.

Implementing plant genetic engineering protocols for the introduction of novel phenotypes into plant species necessitates the use of selectable marker genes to efficiently identify the relatively few cells that actually integrate foreign DNA elements. To this end, a number of selection systems are available including those for resistance toward antibiotics (Bevan and Flavell, 1983; Gritz and Davies, 1983) and herbicides (Thompson et al., 1987; Barry et al., 1992). The former are of no agronomic value, and may evoke negative connotations by the consumer. The latter class of marker genes can provide alternative approaches for effective weed control (Delannay et al., 1995). However, as additional traits are introduced into a crop germplasm through biotechnology by implementing the identical marker gene for selection, it would be prudent to avoid crossing strategies that will bring together duplicated transgenic elements so as to limit the probability of gene silencing (Cerutti, 2003; Vance and Vaucheret, 2001). It would clearly be useful to have in place a strategy for the efficient removal of the marker gene to permit breeders to pyramid novel transgenic traits, while limiting the potential of silencing one or all of the transgenic traits due to the duplicated transgenic alleles in the genome.

A number of strategies have been reported in the literature for the generation of marker-free transgenic plants (McKnight et al., 1987; Goldsbrough et al., 1993; Komari et al., 1996; Dale and Ow, 1991; Gleave et al., 1999; Lu et al., 2001; Zuo et al., 2001; Cotsaftis et al., 2002; Endo et al., 2002). To date, two systems tend to be more efficient in major crop plants, the multi-auto-transformation (MAT) (Endo et al., 2002), and the simultaneous delivery of two T-DNA elements (Komari et al., 1996; Daley et al., 1998; Xing et al., 2000; Miller et al., 2002). In these examples, only nonagronomic reporter genes have been used as a proof of concept. Herein, we report on the production of two high-value fatty acids in the seed storage lipids of marker-free elite transgenic soybean germplasm by the simultaneous delivery of a marker-gene T-DNA element and a T-DNA element carrying the borage {Delta}6 desaturase, followed by elimination of the marker gene T-DNA in segregating progeny.


   MATERIALS AND METHODS
TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Assembly of the Two T-DNA Binary Plasmid
A cDNA of the borage {Delta}6 desaturase was obtained by reverse transcriptase-polymerase chain reaction (RT-PCR) from a pool of poly-(A) RNA derived from developing floral buds. The primers Bor-5:TTTTTCATCCATGGCTGCTCAAATCAAGAAATAC and Bor-3:TTTTTTCTAGATTAACCATGAGTGTGAAGAGC were used in the RT-PCR reaction. The primers introduce an NcoI site and an XbaI site at the 5' and 3' end of the ORF for ease in subsequent subcloning. The PCR product was verified by sequence analysis. The {Delta}6–desaturase gene was fused to the tobacco etch virus translational enhancer element (TEV) (Carrington and Freed, 1990). The resultant element was subsequently cloned between the soybean embryo specific promoter ß-conglycinin and the 3' UTR of 35S CaMV transcript. The {Delta}6–desaturase expression cassette was cloned into the binary vector pPZP102 (Hajdukiewicz et al., 1994) and the resultant vector referred to as pPTN328. The T-DNA element from pPTN328 was subcloned as a ScaI fragment into the binary vector pPTN200, a derivative of pPZP202 (Hajdukiewicz et al., 1994) that harbors a bar gene (Thompson et al., 1987) cassette under the control of the Agrobacterium tumefaciens nos promoter. The resultant two T-DNA binary plasmid is referred to as pPTN331 (Fig. 1) .



View larger version (26K):
[in this window]
[in a new window]
  		Fig. 1. Two T-DNA Binary Vector pPTN331. RB and LB refer to the right border and left border elements, respectively. The restriction sites shown reflect the enzymes used in the hybridization analyses.

 
Soybean Transformations
The two T-DNA plasmid pPTN331 was mobilized into A. tumefaciens strain EHA101 (Hood et al., 1986) via triparental mating (Ditta et al., 1980). Soybean transformations were conducted with the resultant transconjugant as previously described (Zhang et al., 1999; Clemente et al., 2000). Soybean genotypes used in this study were A3237 (Asgrow Seed Co., Des Moines, IA), Thorne (Ohio State University, Columbus) and NE3001 (University of Nebraska, Lincoln).

Characterizations of Soybean Transformants
Primary transformants were established in the greenhouse and grown to maturity. Southern blot analysis was conducted on all the primary transformants and a subset of the progeny derived from selected lines. Total genomic DNA was digested with either HindIII, SstI, or EcoRI. The bar and borage {Delta}6–desaturase genes were used as probes in the hybridization analysis. Northern analysis was conducted on immature embryos as previously described (Buhr et al., 2002) using the borage {Delta}6 desaturase as a probe.

Fatty acid analysis was conducted on cotyledon chips of either T1 or T2 generations. Fatty acid analysis was performed using gas chromatography following the procedure outlined by Butte et al. (1982). Fatty acid levels are reported as a percentage of total fatty acids. The remaining portion of the seed, with embryonic axis, was planted. Herbicide tolerance was ascertained by applying a 100 mg L–1 solution of glufosinate with a cotton swab to the upper surface of a young leaflet approximately 20 d after planting.


   RESULTS
TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Production of Transgenic Soybean Containing the B officinalis {Delta}6 Desaturase
Gamma linolenic acid and STA are produced via desaturation of linoleic and {alpha}-linolenic, respectively (Sayanova et al., 1997). A cDNA clone of the B. officinalis {Delta}6–desaturase gene was generated via RT-PCR from poly-A RNA isolated from developing buds of the herb. The gene was fused to the tobacco etch virus translational enhancer element (Carrington and Freed, 1990) coupled with the soybean ß-conglycinin promoter. The resultant cassette was assembled into a two T-DNA binary vector designated pPTN331 (Fig. 1), in which T-DNA one harbored a bar (Thompson et al., 1987) gene cassette under the control of the nopaline synthase promoter (nos) from A. tumefaciens. The two T-DNA binary plasmid was mobilized into A. tumefaciens strain EHA101 (Hood et al., 1986) and the transconjugant was subsequently used to transform soybean.

Soybean transformations were conducted as previously described (Zhang et al., 1999; Clemente et al., 2000) employing glufosinate for selection. A total of 55 primary transgenic lines were established in the greenhouse. Southern blot analysis revealed that 29 of the primary transgenic lines carried both T-DNA elements (52.7% cotransformation).

Progeny Analyses on Cotransformed Soybean Lines
The 29 cotransformed lines were grown to maturity under greenhouse conditions and progeny analysis was conducted on the T1 generation by monitoring for the four possible phenotypes of herbicide-tolerant/modified fatty-acid profile (HT/GLA/STA), herbicide-sensitive/modified fatty-acid profile (HS/GLA/STA), herbicide-tolerant/wild-type fatty-acid profile (HT/WT), and herbicide-sensitive/wild-type fatty-acid profile (HS/WT). Fatty acid analysis was conducted on cotyledon chips from individual seeds and the remainder of the seed with its associated embryonic axis was subsequently planted. Twenty days after germination, the plantlets (T1) were monitored for herbicide tolerance with a leaf-painting assay as previously described (Zhang et al., 1999). The segregation data on the 29 lines is summarized in Table 1. Among the 29 cotransformed lines, 17 generated T1 progeny with detectable levels of GLA and STA. The average GLA levels in the 17 coexpressing lines within the T1 populations ranged from 3.4 to 28.7%, while average STA levels varied from 0.6 to 4.2% (Table 2. Data from line 402.5 not shown.).


View this table:
[in this window]
[in a new window]
  		Table 1. Segregation analysis (T1) on transgenic soybean lines. GLA, {gamma}-linolenic acid; HT, herbicide tolerant; HS, herbicide sensitive.{dagger}

 

View this table:
[in this window]
[in a new window]
  		Table 2. Fatty-acid profiles of T1 populations of coexpressing transgenic soybean lines. GLA, {gamma}-linolenic acid; STA, stearidonic acid.{dagger}

 
Northern analysis was conducted on three developing T2 embryos derived from a T1 individual from line 404-1 in which GLA and STA levels were observed at 36.7 and 3.7%, respectively. The data revealed high {Delta}6–desaturase transcript levels in the transgenic immature seed and lack of a corresponding message in a wild-type control immature seed (Fig. 2) . We further characterized one of the cotransformed lines, 400-1, in which the fatty-acid profile in the seed storage lipids was not altered (Table 1). Southern analysis revealed that two of the T1 plants had the identical hybridization pattern as the parental (T0) when the blot was probed with the bar gene, while a third T1 inherited only one of the three bar hybridizing elements. When the {Delta}6 desaturase was used as a probe, an extra {Delta}6–desaturase T-DNA element that was not detectable in the parental plant (Fig. 3) was inherited by only one of the three T1 individuals characterized. One of the other two T1 individuals inherited the {Delta}6–desaturase T-DNA hybridizing element detected in the T0 (Lane 2, Fig. 3), and the other inherited neither (Lane 3, Fig. 3). This observation suggested that in the parental line (T0), the second {Delta}6–desaturase integration event existed as a chimera, at a level below detection by southern analysis, that was inherited in a subset of the T1 individuals. Moreover, the southern data also indicate that the {Delta}6–desaturase T-DNA alleles that were integrated in line 400-1 were probably truncated and/or rearranged, which would explain the wild-type fatty-acid profile observed in the T1 individuals derived from the line. The probable truncation of the {Delta}6–desaturase T-DNA alleles that were inherited is reflected in the lack of the expected 1.3-kb HindIII (Fig. 1) southern blot hybridization signal when the {Delta}6 desaturase was used as a probe (Fig. 3). Likely, the {Delta}6-desaturase alleles were missing the 3' region of the gene or rearranged alleles were integrated.



View larger version (104K):
[in this window]
[in a new window]
  		Fig. 2. Northern blot analysis on immature embryos derived from line 404-1. Top panel, northern blot. Lower panel, ethidium bromide gel of northern blot. Lane 1, wild-type soybean immature embryo. Lanes 2 to 4, T2 immature embryos derived from line 404-1.

 


View larger version (105K):
[in this window]
[in a new window]
  		Fig. 3. Southern blot analysis on line 400-1. Upper panel, {Delta}6-desaturase probe. Lower panel, bar gene probe. Lane 1, parental (T0). Lanes 2 to 4, derived T1 individuals. Lane 5 (WT), wild-type soybean DNA. Lane 6 (C), 50 pg pPTN331 (see Fig. 1). DNAs digested with HindIII. Designation HT above the lane indicates the individual was herbicide tolerant.

 
Among the 29 cotransformed lines, eight produced seed with the phenotype of interest (HS/GLA/STA). However, only four of the eight lines that produced T1 seed with the desired phenotype (HS/GLA/STA) were marker-free, lines 419-2 and 420-5 (Fig. 4A) , 414-5 (Fig. 4B), and 414-2 (Fig. 4C. 414-9 data not shown. T1 individuals harbor bar gene.). This frequency represents {approx}7% of the total transgenic lines generated (4/55). The southern blot in Fig. 4C shows the data from four HS/GLA T1 individuals derived from line 414-2 and the one HS/GLA T1 individual from line 414-3. The data reveal that three of the four HS/GLA T1 individuals from line 414-2 were actually devoid of the bar T-DNA element, while the other T1 from 414-2 and the single T1 with the HS/GLA phenotype from 414-3 harbored the bar T-DNA element. Figure 4B displays analysis results from 411-5, 414-5, and 418-6 T1 individuals with the HS/GLA phenotype. Included in Fig. 4B is a T1 individual derived from line 418-6 that displayed some herbicide damage, but was categorized as HT/GLA T1 in Table 1. The data show that from this set of T1 individuals only one of the 414-5 T1 plants was actually marker-free, while the T1 individuals derived from the other lines (411-5 and 418-6) contained bar hybridizing sequences. Molecular characterization of the T1 HS/GLA individuals from the last two lines, 419-2 and 420-5, is shown in Fig. 4A along with a subset of HT/GLA T1 individuals from these lines. Here, the molecular data correlated with the HS phenotype in that all T1 individuals that were herbicide sensitive lacked bar hybridizing sequences, and vis-à-vis with respect to the HT T1 individuals.



View larger version (53K):
[in this window]
[in a new window]
  		Fig. 4. (A) Southern blot analysis on herbicide-sensitive/modified fatty-acid profile (HS/GLA/STA) T1 individuals derived from lines 419-2 and 420-5. Top panel, {Delta}6 desaturase probe. Lower panel, bar gene probe. Lanes 1 to 4, T1 individuals from line 419-2. Lanes 5 to 8, T1 individual from line 420-5. Lane 9, wild-type (WT) control. Lane 10, 50 pg of pPTN331 positive control. DNAs digested with Sst I. Numbers above each column indicate percentage of GLA in the fatty-acid analysis. HT and HS refer to herbicide tolerant and herbicide sensitive, respectively. (B) Southern blot analysis on HS/GLA/STA T1 individuals derived from lines 411-5, 414-5, and 418-6. Figure description as in (A). Lanes 1 and 2, T1 individuals from line 411-5. Lanes 3 to 6, T1 individuals from line 414-5. Lanes 7 to 10, T1 individuals from line 418-6. Lane 11, wild-type (WT) control. Lane 12, 50 pg of pPTN331 positive control. (C) Southern blot analysis on GLA/STA T1 individuals derived from lines 414-2 and 414-3. Figure description as in (A). Lanes 1 to 4, T1 individuals from line 414-2. Lane 5, T1 individual from line 414-3. Lane 6, wild-type (WT) control. Lane 2, 50 pg of pPTN331 positive control.

 
Stability of the novel fatty-acid profile in six of the coexpressing transgenic lines was ascertained by monitoring T2 seed. T2 seed derived from marker-free T1 individuals representing lines 414-2, 419-2, and 420-5 were included in this analysis. The tabulated mean fatty acid levels are shown in Table 3. The data set in Table 3 does not include the null recessives. The T1 individuals selected for the T2 data analysis from lines 419-2, 414-2, and 404-7 were heterozygous, and the T2 seed were segregating for the GLA/STA phenotype in ratios of 15:5, 20:2, and 26:5, respectively. The selected T1 individuals from which T2 seed were collected for lines 420-5, 398-6, and 411-5 all appeared to be homozygous for the novel fatty-acid profile. The mean GLA and STA levels in the T2 populations (Table 3) from the selected lines were comparable with those observed within the respective T1 samples analyzed (Table 2), reflecting the stability of the novel phenotype through meiosis. Southern blot analysis was conducted on six T2 individuals (Fig. 5) derived from the marker-free T1 plant recovered from line 420-5 (Fig. 4A). The data reveal a rather simple insert, one locus, with one to two copies at the site of integration and, as expected, remained marker-free (Fig. 5).


View this table:
[in this window]
[in a new window]
  		Table 3. Fatty-acid profiles on T2 populations on a subset of the transgenic soybean lines. GLA, {gamma}-linolenic acid; STA, stearidonic acid.{dagger}

 


View larger version (77K):
[in this window]
[in a new window]
  		Fig. 5. Southern blot analysis on T2 individuals derived from marker-free T1 seed of line 420-5. Upper panel, {Delta}6 desaturase probe. Lower panel, bar gene probe. Lanes 1-6, T2 individuals from marker-free population of line 420-5. Lane 7, wild-type (WT) soybean. Lane 8, 50 pg pPTN331 positive control. DNAs digested with EcoRI. Numbers above the column refer to the percentage of GLA in the T2 seed sample. HS indicates all individuals were scored herbicide sensitive.

 

   DISCUSSION
TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
Linoleic acid and {alpha}-linolenic fatty acid pools in plants can be converted to GLA and STA, respectively, via the action of a {Delta}6 desaturase (Griffiths et al., 1996; Sayanova et al., 1997; Sayanova et al., 1999; Liu et al., 2001). Sayanova et al. (1997) inserted the B. officinalis {Delta}6–desaturase gene down stream of the 35S CaMV promoter. Transgenic tobacco lines that harbored this constitutive {Delta}6–desaturase cassette produced significant levels of GLA and moderate levels of STA in vegetative tissues; however, relatively low levels of the novel fatty acids were produced in mature seed, <3.0% GLA and no detectable levels of STA (Sayanova et al., 1999). The authors speculated on a number of possibilities that can account for the lack of significant production of GLA and STA in mature tobacco seed, timing of expression of the transgene during seed development, substrate competition, or preferred specificities of the native fatty acids by the seed acyltransferases for incorporation into TAG. In canola, on the other hand, the lack of sufficient accumulation in the seed storage lipids of GLA and STA was overcome by dual, seed-specific, expression of fungal {Delta}12- and {Delta}6-desaturase genes (Liu et al., 2001). In this case, the combination of genes was required to first shift the relative high oleic acid pool to linoleic acid ({Delta}12 activity) to provide a sufficient substrate for the {Delta}6 desaturase. Importantly, this later work demonstrated that accumulation of these unusual fatty acids was not limited from lack of incorporation into the triacylglycerol backbone.

The fatty-acid profile in soybean is approximately 13% palmitic, 4% stearic, 18% oleic, 55% linoleic, and 10% {alpha}-linolenic acids. This is suggestive that a significant endogenous substrate pool for the {Delta}6–desaturase activity is present, making this commodity crop an ideal target for the production of these two novel fatty acids. The results presented here demonstrate that using a seed specific promoter to regulate expression of the borage {Delta}6–desaturase gene and implementing the two T-DNA binary system to simultaneously deliver two T-DNA elements, marker-free transgenic soybean lines can be recovered that produce significant levels of these novel fatty acids (Table 2).

Nutritional benefits have been attributed to diets supplemented with GLA. In addition, STA, the precursor to eicosapentaenoic acid and docosahexaenoic acid, may prove to be a more effective omega-3 fatty acid in diets than {alpha}-linolenic (Kris-Etherton et al., 2001). Moreover, STA may also serve as a substitute for fish oil as a route for long chain omega-3 fatty acids, which can augment stability and taste (Kris-Etherton et al., 2001).

Modulating seed metabolism in a major oil crop such as soybean can serve as a cost-effective route for the production of high-value molecules such as GLA and STA. This, in turn, provides the consumer an additional option to acquire the health benefits from these nutraceuticals without altering their dietary consumption (Knutzon and Knauf, 1998). The novel transgenic soybean lines described herein are the first report of a value-added trait introduced into a major crop plant free of a selectable marker gene. Field trials are underway to evaluate the agronomic performance of a population derived from the marker-free soybean line 420-5. The derived oil and meal from the field trails will subsequently be tested in animal feeding studies with pigs, chickens, and hamsters to monitor any potential beneficial effects of the novel soybean fatty-acid profile on the animals. Moreover, an attempt to enhance STA levels in soybean seed storage lipids is being pursued by dual expressing the borage {Delta}6 desaturase with the Arabidopsis {Delta}15 desaturase (FAD3). Here, we hope to convert a significant portion of the seed fatty acids to {alpha}-linolenic acid (FAD3 action), and thus provide a larger substrate pool for STA production.


   ACKNOWLEDGMENTS
 
Funding for the research was provided by UNL's Center for Biotechnology and the Nebraska Research Initiative. Gratitude is extended to Samantha Link and Melissa Lindemann for greenhouse care of the plants. A special thanks is extended to R.A. Zimmerman for creative inputs to the laboratory.


   NOTES
TOP
 NOTES
ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
1 Note: A preliminary report of this research has previously been published. See Clemente et al. (2003). Back

This publication is a contribution of the University of Nebraska Agricultural Research Division, Lincoln, NE, Journal Series No. 14166.

2 These authors contributed equally to this work. Back

Received for publication May 26, 2003.


   REFERENCES
TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 




This article has been cited by other articles:


Home page
 Plant Physiol.Home page
T. E. Clemente and E. B. Cahoon
Soybean Oil: Genetic Approaches for Modification of Functionality and Total Content
Plant Physiology, November 1, 2009; 151(3): 1030 - 1040.
[Full Text] [PDF]

Home page
 J. Nutr.Home page
J. Whelan
Dietary Stearidonic Acid Is a Long Chain (n-3) Polyunsaturated Fatty Acid with Potential Health Benefits
J. Nutr., January 1, 2009; 139(1): 5 - 10.
[Abstract] [Full Text] [PDF]

Home page
 Plant Physiol.Home page
H. G. Damude and A. J. Kinney
Enhancing Plant Seed Oils for Human Nutrition
Plant Physiology, July 1, 2008; 147(3): 962 - 968.
[Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (15)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sato, S.
Right arrow Articles by Clemente, T.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Sato, S.
Right arrow Articles by Clemente, T.
Agricola
Right arrow Articles by Sato, S.
Right arrow Articles by Clemente, T.
Related Collections
Right arrow Soybean
Right arrow Cell Biology & Molecular Genetics

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
The SCI Journals Agronomy Journal Vadose Zone Journal
Journal of Natural Resources
and Life Sciences Education		 Soil Science Society of America Journal
Journal of Plant Registrations Journal of
Environmental Quality		 The Plant Genome