HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Figures Only Full Text (PDF) Free Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via ISI Web of Science (4) Citing Articles via Google Scholar Google Scholar Articles by Real, D. Articles by Echenique, M. Search for Related Content PubMed Articles by Real, D. Articles by Echenique, M. Agricola Articles by Real, D. Articles by Echenique, M. Related Collections Crop Genetics Other Forage Crops

CROP BREEDING, GENETICS & CYTOLOGY

Reproductive and Molecular Evidence for Allogamy in Lotononis bainesii Baker

^a Forage Legume Department, National Institute of Agricultural Research, INIA Tacuarembó, Ruta 5 Km 386, Tacuarembó, Uruguay
^b Biotechnology Unit, National Institute of Agricultural Research, INIA Las Brujas, Ruta 48 km 10, Canelones, Uruguay
^c Dep. of Agronomy, Univ. of Florida, Gainesville, FL 32611-0500, USA

^* Corresponding author (dreal{at}inia.org.uy).

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION CONCLUSIONS REFERENCES

 
Reproductive characteristics can influence seed production and the amount and distribution of genetic variation within populations. Lotononis bainesii Baker is a subtropical forage legume from southern Africa that earlier researchers reported as having a cleistogamous form of reproduction. More recent reports suggest that species in the genus Lotononis Section Listia reproduce chasmogamously. Research from this study suggests that this species needs pollinators to produce seed and that genotypes exist that are self-incompatible. The use of sequence characterized amplified regions (SCAR) and cleaved amplified polymorphic sequence (CAPS) markers demonstrated that L. bainesii is highly allogamous.

Abbreviations: AFLP, amplified fragment length polymorphism • CAPS, cleaved amplified polymorphic sequence • INIA, National Institute of Agricultural Research • MAS, marker assisted selection • NCBI, National Center for Biological Information • PCR, polymerase chain reaction • RAPD, random amplified polymorphic DNA • SCAR, sequence characterized amplified regions • SNP, single nucleotide polymorphism • UFRGS, Federal University of Rio Grande Do Sul

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION CONCLUSIONS REFERENCES

 
A MAJOR CONSIDERATION in domestication of any forage legume species is mode of pollination and reproduction (Bullita et al., 1993). Although it may seem simplistic to determine if a species is self- or cross-pollinated, for many of the undomesticated species, definitive studies have not been conducted and are critical before undertaking crop improvement research.

On the basis of floral development, L. bainesii was reported to be cleistogamous by Hutton (1960) and Byth (1964). Hutton (1960) reported that anthers dehisced a few hours before the flowers opened and Byth (1964) reported that pollen tubes in the stigma were first observed after the visible corolla was half the length of the calyx, while the flower was still closed. Species within the genus Lotononis Sec. Listia were reported to be chasmogamous by Van Wyk (1991). Van Wyk (1990) also studied the occurrence of cleistogamy in this group.

Marker systems based on DNA have proven to be valuable tools for studying the reproductive system of a species. In particular, random amplified polymorphic DNA (RAPD; Welsch and McClelland, 1990; Williams et al., 1990) is now commonly used for a variety of ecological and botanical genetic analyses. However, the use of RAPDs to describe mating systems can be more difficult because of the dominant nature of the bands.

Loci specific markers such as SCARs and CAPS are preferred to RAPD markers because their PCR (polymerase chain reaction) amplification is less sensitive to reaction conditions and they are more likely to be codominant makers (Paran and Michelmore, 1993; Weng et al., 1998; Albertini et al., 2001). Recently, loci specific markers have been used for studies of population genetics, paternity analysis, mapping genes of interest, map-based cloning, and marker assisted selection (MAS) in several organisms (Bullita et al., 1993; Konieczny and Ausubel, 1993; Barrel et al., 1997; Sorri et al., 1999; Kittelson and Maron, 2000; Albertini et al., 2001; Isidore, 2002).

Since 1999, a breeding and improvement program with L. bainesii has been conducted at the National Institute of Agricultural Research, INIA, Uruguay. The objective of this research was to determine the mode of reproduction of L. bainesii through pollination studies in controlled crossing experiments and through monitoring flower development. Molecular SCAR and CAPS markers have been utilized to determine if progenies were the product of self- or cross-pollination under natural conditions with pollinators present.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION CONCLUSIONS REFERENCES

 
Floral Development
The study of flower development was conducted on five random flowers taken from each of 10 categories of flower size increasing in length by 1 mm from 2 mm to 11 mm. Flowers were dissected and the length (mm) of the calyx, corolla, large anther ring, small anther ring, ovary, and style were measured under a dissecting microscope (Fig. 1) . Position of the stigma with reference to the highest anther, anther dehiscence, and presence of pollen on the stigma were recorded. The flowers were considered open when the standard petal started to separate from the other petals.

View larger version (126K): [in this window] [in a new window]   Fig. 1. Flower of L. bainesii showing the stigma above of the anthers (a; arrow) and two pictures of the fruit (b and c); note the long hooked stylar tissue adhering to the pod.

Pollination Studies
Flowers from 581 L. bainesii inflorescences from 15 parent plants were hand-crossed in the summer of 1999-2000 in an insect proof glasshouse. Hand emasculation was done before anther dehiscence and crossing occurred 48 h after emasculation.

The following summer (2000-2001), individual inflorescences or florets from plants grown in 10-L buckets were subjected to different treatments. First, 71 inflorescences and 35 florets were bagged to prevent insect pollination and (i) fixed with a wire to the ground to avoid wind tripping, (ii) left untouched for the length of the experiment allowing for wind tripping, (iii) hand-pollinated with a brush when flowers were fully open, (iv) pollinated with honey bees brought in jars from areas more than 3 km away without L. bainesii pollen, and (v) emasculated and left untouched inside the bag. Second, 24 inflorescences were tagged but not bagged and both the emasculated inflorescences and control flowers which received no floral manipulation were left free to receive honey-bee visits.

In summer and autumn 2002, a new set of crosses were made with a reduced number of genotypes. Two sets of three full-sib mother plants (6s1; 6s2; 6s3 and 71s1; 71s2; 71s3) were crossed to three pollen donor plants (22s, 67s and 85s). All seeds and flowers on the nine plants were removed and the plants were placed in an insect-proof glasshouse. Newly developed individual flowers of each mother plant were tagged and a total of 61 crosses were made with the pollen donor plants. Also, 96 flowers of the mother plants were tagged and self-pollinated by hand.

In spring 2002, the nine plants used in the previous crossing exercise were cloned and a complete set of plants were placed in insect-proof glasshouses at INIA Tacuarembó in northern Uruguay and at INIA Las Brujas in southern Uruguay to study their ability to produce seeds without pollinators. After about 2 mo, individual plants were taken to different locations and allowed to be self-pollinated by insects. There is no L. bainesii sown in Uruguay.

Molecular Markers
DNA Extraction
Ten milligrams of young tissue from 10 to 20 actively growing buds per plant were used to extract DNA (Edwards et al., 1991). Several RAPD fingerprints were produced on the genotypes belonging to the 15 parent plants and these were the basis for the development of genomic specific primers (SCAR). The potential of random primers to detect genetic diversity in L. bainesii was assessed with 14 decamer primers (Operon Technologies Inc., Alameda, CA; Table 1). The reaction conditions for amplification of RAPD segments with 40 ng of genomic DNA were as described by Kongkiatngam et al. (1996). The RAPD marker loci were named by the primer and estimated molecular weight of the segment amplified.

Transformed cells were grown at 37°C overnight on a selective Luria-Bertani medium [1.0% (w/v) Tryptone, 0.5% (w/v) yeast extract, 1.0% (w/v) NaCl, pH 7.0] supplemented with 50 µg/mL of ampicillin and 0.8 mg/mL of X-gal (5-bromo-4-chloro-3-indolyl-ß-D galactosidase). For plasmid DNA purification the Concert Rapid Plasmid Purification System (GibcoBRL, Life Technologies, UK) was used following the procedures indicated by the manufacturers. Sequencing reactions were performed from the plasmid with an Applied Biosystems PerkinElmer Big Dye Terminator cycle sequencing kit (PE Biosystems, Warrington, UK), M13 universal forward and reverse primers, and an ABI310 automated sequencer (PE Biosystems, La Jolla, CA, USA). Sequenced RAPD fragments were searched against sequence databases with BLAST software at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/blast/; verified 7 October 2003). We detected no significant similarities to sequences in the NCBI/GenBank databases. The first two sequences of this species are publicly available with codes CC149835 and CC149836.

SCAR Marker Design
Using the sequence information of each cloned RAPD band, we developed two oligonucleotides to be used as SCAR primer pairs. The SCAR primers were designed by two methods. The first method extended the RAPD primer 14 bases from its 3' end (SCAR I and III). The second method used the computer program Primer3 Software, release 0.9 (Rozen and Skaletsky, 1998), to identify internal sequences suitable for PCR analysis. These internal sequences were used as the sequences for 20-mer SCAR primer pairs (SCAR II and IV).

Primers designed against sequenced RAPD fragments are as follows:

• SCAR I: ForwardACGACCGACAGTATAAGCAGCGGA
  
• ReverseACGACCGACAACCTCTAGATCGAT
  
• SCAR II: ForwardAGCCCTCCCAAGTATCCCTA
  
• ReverseTGGATCGCCTAGGTAAGTGC
  
• SCAR III: ForwardACGACCGACAACAGGACGAG TAAA
  
• ReverseACGACCGACAGAAGCAATCATCAA
  
• SCAR IV: ForwardCTGGAATTCGGGAACTTGAA
  
• ReverseCAGTTGTGGCCAAGTTTGAA
  

SCAR Amplification
Different reaction conditions and touchdown-method cyclings were used to optimize the amplification of the SCAR markers. The 20-µL reaction volume contained 100 ng of genomic DNA, 20 mM Tris-HCl pH 8.4, 50 mM KCl, 0.1 mM EDTA (ethylenedinitrilo tetraacetic acid), 1.5 mM MgCl₂ with 200 µM each of dCTP, dGTP, dATP and dTTP, 0.2 µM of each forward and reverse primer, 1.5 U of Taq DNA Polymerase (Invitrogen Life Technologies, CA, USA) in a Genius thermal cycler (Techne Ltd., Cambridge, UK).

Initially, PCR was performed to test various annealing temperatures searching highly stringent reaction conditions with a final temperature of annealing varying from 60 to 65°C. Touchdown-method cycling conditions (Bryan et al., 2002) used for the SCAR amplifications were as follows: initial denaturation step of 4 min at 94°C, one cycle of 3 min at 94°C, 1 min at 65°C, 1 min at 72°C; followed by five cycles of 30 s at 94°C, 30 s at 65°C, 30 s at 72°C, decreasing 1 degree per cycle; followed by 24 cycles of 30 s at 94°C, 30 s at 60°C, 30 s at 72°C; followed by 5 min at 72°C. Amplification products were separated by electrophoresis in 2% (w/v) agarose gels.

Cleaved Amplified Polymorphic Sequence
The CAPS assays were performed by digesting locus-specific PCR amplicons with one or more restriction enzymes and separating the digested DNA on agarose or polyacrylamide gels. The CAPS analysis was concentrated on the genotypes used as parents of crosses conducted in summer and autumn 2002 in which monomorphic SCAR bands were observed and converted to polymorphic bands. On the basis of the genome sequences of the RAPD fragment and through the use of specific software (Web Cutter, http://rna.lundberg.gu.se/cutter2/index.html; verified 7 October 2003), it was possible to find putative sites for restriction enzyme analysis. The enzymes TaqI, MboII, and MseI showed at least five theoretical restriction sites in the analysis of the sequence.

The monomorphic bands obtained with SCAR primers were digested with several restriction enzymes under the recommended incubation temperatures indicated by the manufacturers (Gibco BRL, Life Technologies, UK). All the digested samples were electrophoresed on polyacrylamide gels as reported by Bryan et al. (2002). Electrophoresis was performed with the Sturdier (Amersham Biosciences Corp, SF, USA) system using 1x TBE (Tris boric acid EDTA) buffer. The silver staining method (Tixier et al., 1997) was used to reveal the bands.

Studies on Open-Pollinated Progenies
On the basis of the molecular behavior of the SCAR, tester genotypes, plants with only one band were chosen as mother tester plants. The banding pattern of three families corresponding each to one mother tester plant and 15 open-pollinated progenies were studied. To increase the chance of it having been pollinated by a different pollen donor, each of the 15 open-pollinated progenies corresponded to 15 different inflorescences of the same plant.

A two-band plant that could not be used as a tester genotype in the SCAR analysis was used as mother plant in the CAPS analysis; TaqI was used to study 10 open-pollinated progenies.

	RESULTS AND DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION CONCLUSIONS REFERENCES

 
Floral Development
The corolla was first visible emerging from the calyx when flowers were 4 mm long; the calyx grew very little until the final floral size at 11 mm was reached, at which time the calyx was 5 mm long. Anthers in L. bainesii flowers were arranged in two rings, an upper ring of five larger anthers and a lower ring of five smaller anthers (Fig. 1).

Ten percent of the flowers had stigmas below the top anther ring, 20% of the flowers had stigmas at the same level as the anther ring, and 70% of stigmas were from 0.1 to 1.0 mm above the top anthers. Anthers showed evidence of dehiscence when the flower was longer than 7 mm. The standard petal began to open when the flower size was 9 mm. Some pollen was found on stigma 8.5 to 11 mm long, but this may be an artifact caused by manipulation of the flowers while dissecting. Despite the morphological structures, the stigma was above the top of the anther level (long-style) in 95% in flowers longer than 7.6 mm. Therefore, without pollen movement from the anthers to the stigma by pollinators, self-pollination would be unlikely.

All L. bainesii pods have a long style attached, suggesting that it is a chasmogamous species (Fig. 1). Observations of flower development, indicate the allogamous predisposition of L. bainesii flowers, but are not sufficient for definitive conclusions about the breeding system.

Pollination Studies
From the 581 crosses made in 1999-2000, 279 hybrids were obtained (Table 2). We excluded plants that had less than 10 crosses with success values of 0 or 100%. The success rate by selfing was 9% in comparison with an average success rate of 54% for crossings. Moreover, it was observed that none of the nonmanipulated inflorescences set seed inside the insect-proof glasshouse, suggesting that this species is not cleistogamous and that pollinators are required for normal seed production.

View larger version (58K): [in this window] [in a new window]   Fig. 2. Polymorphism shown by RAPD analysis, primer G-17, in parental material. The arrow indicates a fragment used for cloning and sequencing to develop the SCAR marker. The DNA ladder (Promega Corp., Madison, WI) on right consists of 11 fragments that range in size from 100 to 1000 bp in 100-bp increments, plus an additional fragment at 1500 bp. The 500-bp fragment, present at increased intensity, is indicated by an arrow.

The tester genotypes chosen as mother plants had one band. Figure 3 shows the band profile obtained from one tester genotype and its 10 self-pollinated progenies. As expected, only one band was observed in the progeny of a selfed mother plant. Conversely, with the SCAR II primer, more than one band was present in 53, 67, and 80% of the 15 open-pollinated progeny of three different tester genotypes (Fig. 4) .

View larger version (43K): [in this window] [in a new window]   Fig. 3. Ten self-pollinated progenies and the mother plant on the right next to the ladder marker obtained with the SCAR II. The fragment with increased intensity in the DNA ladder (Promega Corp.) on the right of the gels is 500 bp.

View larger version (94K): [in this window] [in a new window]   Fig. 4. SCAR electrophoretic pattern of 15 individual genotypes of three inflorescences (a, b, and c) from open pollinated flowers obtained with SCAR II primer. The tester genotype used as a mother plant has only one band. The fragment with increased intensity in the DNA ladder (Promega Corp.) on the right of the gels is 500 bp.

View larger version (63K): [in this window] [in a new window]   Fig. 5. Analysis of CAPS markers utilizing the enzyme TaqI in an open pollinated progeny of a mother plant (M). The arrows indicate the non maternal allele present in the progeny.

	CONCLUSIONS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION CONCLUSIONS REFERENCES

 
Floral development studies revealed that the upper stigma position related to the anther rings before anther dehiscence facilitates cross-pollination. Anther dehiscence clearly occurs at an advanced stage of the flower development when the stigma is already on top of the anthers. The pollination studies demonstrated that L. bainesii needs pollinating agents to set seed. Lotononis bainesii is primarily an allogamous species that also has the ability to set some self-pollinated seed.

By the combined use of SCAR and CAPS markers, progenies of all mother plants (one- and two-band plants) could be screened to detect cross-pollination. The molecular tools developed to determine the reproductive system of L. bainesii were effective in identifying additional alleles present in the progeny, but not in the mother plant. Breeding in L. bainesii should be performed as for an allogamous species and seed production fields should be supplemented with pollinators.

	ACKNOWLEDGMENTS

 
The authors wish to acknowledge the INIA technicians M. Zarza, R. Mérola, A. Viana, and E. Solares the Brasilian students of the Federal University of Rio Grande Do Sul (UFRGS) (R. Jaworski dos Santos and F. Machado Prates da Silveira) for their support in the glasshouse, field, and laboratory work for this project. We also thank K. McLean and G.J. Bryan for primer design. We wish to thank INIA the Head of Pasture Program, Mr. D.F. Risso, the Head of the Biotechnology Unit Dr. M. Francis- Mr. F. Capdevielle and the Directors of INIA Tacuarembó (Dr. E.J. Berretta) and INIA Las Brujas (Dr. C. Paolino). We also acknowledge the useful comments that the editors of Crop Science provided on the manuscript. This work was supported by INIA and the work agreement N° 308 between INIA, Uruguay, and the University of Florida, USA, funded by Project N° 3. INIA-BIDII and the Clemente Estable Fund N° 8151, DINACYT, Ministry of Culture and Education, Uruguay.

Received for publication February 12, 2003.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS AND DISCUSSION CONCLUSIONS REFERENCES

 

• Albertini, E., G. Barcaccia, A. Porceddu, S. Sorbolini, and M. Falcinelli. 2001. Mode of reproduction is detected by Parth1 and Sex1 SCAR markers in a wide range of facultative apomictic Kentucky bluegrass varieties. Mol. Breed. 7:293–300.
• Barrel, P.J., J.E. Richardson, and R.C. Gardner. 1997. Molecular markers and experimental pollinations reveal self-fertility and high levels of natural inbreeding in the New Zealand endemic tree Vitex lucens (puriri). N.Z. J. Bot. 35:535–543.
• Bryan, G.J., K. McLean, J.E. Bradshaw, W.S. De Jong, M. Phillips, L. Castelli, and R. Waugh. 2002. Mapping QTLs for resistance to the cyst nematode Globodera pallida derived from the wild potato species Solanum vernei. Theor. Appl. Genet. 105:68–77.[ISI][Medline]
• Bullita, S., R. Floris, M.D. Hayward, and F. Veronesi. 1993. The reproductive system of a Lolium rigidum Gaud. population from Sardinia and its implications for breeding. Plant Breed. 111:312–317.
• Byth, D.E. 1964. Breeding system and chromosome number in Lotononis bainesii Baker. Nature 202:830.[Medline]
• Edwards, K., C. Johnstone, and C. Thompson. 1991. A simple and rapid method for the preparation of plant genomic DNA for PCR analysis. Nucleic Acids Res. 19:1349.[Free Full Text]
• Hutton, E.M. 1960. Flowering and Pollination in Indigofera spicata, Phaseolus lathyroides, Desmodium unicinatum, and some other tropical pasture legumes. Empire J.Exp. Agric. 28(111):235–243.
• Isidore, E. 2002. Construction and application of a multifunctional ultra-high-density genetic map in potato. Ph.D. thesis, University of Dundee, Scotland.
• Kittelson, P.M., and J.L. Maron. 2000. Outcrossing rate and inbreeding depression in the perennial yellow bush lupine, Lupinus arboreus (Fabaceae). Am. J. Bot. 87(5):652–660.
• Kongkiatngam, P., M.J. Waterway, B.E. Coulman, and M.G. Fortin. 1996. Genetic variation among cultivars of red clover (Trifolium pratense L.) detected by RAPD markers amplified from bulk genomic DNA. Euphytica 89:355–361.
• Konieczny, A., and F. Ausubel. 1993. A procedure for mapping Arabidopsis mutations using co-dominant ecotype-specific PCR-based markers. Plant J. 4(2):403–410.
• Paran, I., and R.W. Michelmore. 1993. Development of reliable PCR-based markers linked to downy mildew resistance genes in lettuce. Theor. Appl. Genet. 85:985–993.
• Rozen, S., and H.J. Skaletsky. 1998. Primer 3. Code available at http://www-genome.wi.mit.edu/genome_software/other/primer3.html; verified 7 October 2003.
• Sorri, V.A., K.N. Watanabe, and J.P.T. Valkonen. 1999. Predicted kinase-3^a motif of a resistance gene analogue as a unique marker for virus resistance. Theor. Appl. Genet. 99:164–170.
• Tixier, M.H., P. Sourdille, M. Röder, P. Leroy, and M. Bernard. 1997. Detection of wheat microsatellites using a non radioactive silver-nitrate staining method. J. Genet.Breed. 51:175–177.
• Tragoonrung, S., V. Kanizin, P.M. Hayes, and T.K. Blake. 1992. Sequence-tagged-site-facilitated PCR for barley genome mapping. Theor. Appl. Genet. 84:1002–1008.
• Van Wyk, B.-E. 1990. Studies in the genus Lotononis (Crotalaria, Fabaceae). 13. Two new species and notes on the occurrence of cleistogamy in the section Leptis. Bothalia 20(1):17–22.
• Van Wyk, B.-E. 1991. A Synopsis of the Genus Lotononis (Fabaceae: Crotalarieae). Contributions from the Bolus Herbarium N° 14. Rustica Press (PTY), Wynberg, Cape, South Africa.
• Welsch, J., and M. McClelland. 1990. Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Res. 18:7213–7218.[Abstract/Free Full Text]
• Weng, C., T.L. Kubisiak, and M. Stine. 1998. SCAR markers in a longleaf pine x slash pine F₁ family. For. Genet. 5(4):239–247.
• Williams, J.G.K., A.R. Kubelik, K.J. Livak, J.A. Rafalski, and S.V. Tingey. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res. 18:6531–6535.[Abstract/Free Full Text]

This article has been cited by other articles:

				D. Real, M. Dalla Rizza, R. Reyno, and K. H. Quesenberry Breeding System of the Aerial Flowers in an Amphicarpic Clover Species: Trifolium polymorphum Crop Sci., July 30, 2007; 47(4): 1401 - 1406. [Abstract] [Full Text] [PDF]

				R. M. NAIR, I. S. DUNDAS, M. WALLWORK, D. C. VERLIN, L. WATERHOUSE, and K. DOWLING Breeding System in a Population of Trigonella balansae (Leguminosae) Ann. Bot., December 1, 2004; 94(6): 883 - 888. [Abstract] [Full Text] [PDF]

This Article Abstract Figures Only Full Text (PDF) Free Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via ISI Web of Science (4) Citing Articles via Google Scholar Google Scholar Articles by Real, D. Articles by Echenique, M. Search for Related Content PubMed Articles by Real, D. Articles by Echenique, M. Agricola Articles by Real, D. Articles by Echenique, M. Related Collections Crop Genetics Other Forage Crops