Published in Crop Sci. 43:2252-2256 (2003).
© 2003 Crop Science Society of America
677 S. Segoe Rd., Madison, WI 53711 USA
GENOMICS, MOLECULAR GENETICS & BIOTECHNOLOGY
Development of SCAR Marker Linked to a Major QTL for High Fiber Strength and Its Usage in Molecular-Marker Assisted Selection in Upland Cotton
Wangzhen Guoa,
Tianzhen Zhang*,a,
Xinlian Shena,
John Z. Yub and
Russell J. Kohelb
a National Key Laboratory of Crop Genetics & Germplasm Enhancement, Cotton Research Inst., Nanjing Agric. Univ., Nanjing 210095, China
b USDA ARS, Southern Plain Agriculture Research Center, Crop Germplasm Research Unit, College Station, TX 77845, USA
* Corresponding author (cotton{at}njau.edu.cn).
 |
ABSTRACT
|
|---|
Cotton fiber is a basic raw material in the textile industry. All the changes in spinning technology require unique and often greater cotton fiber quality, especially strength, for processing. On the basis of genetic analysis and molecular mapping, a major quantitative trait locus (QTL) for fiber strength was identified in 7235, an Upland cotton (Gossypium hirsutum L.) germplasm line in our institute, which possesses super quality fiber properties. Eight molecular markers, two simple sequence repeat (SSRs) and six random amplified polymorphic DNA (RAPDs) markers, were linked to the QTL. The objective of this study was to develop rapid and reliable sequence characterized amplified region (SCAR) markers linked to the QTL for marker-assisted selection (MAS). Two RAPD markers, UBC4311920 and UBC7571365, were converted to SCAR markers after sequencing the two ends of the two polymorphic DNA fragments. Only SCAR4311920 marker detected polymorphism between TM-1 and 7235, whereas SCAR7571365 showed monomorphism. SCAR4311920 marker was explored to determine its stability in (7235 x TM-1) F2 with UBC4311920 marker as a control and to screen the major fiber strength QTL of (7235 x Simian 3) BC1F4 population for transferring good fiber quality. The result showed that the specific SCAR4311920 marker could be applied to large-scale screening for the presence or absence of the major fiber strength QTL in breeding populations.
Abbreviations: MAS, marker-assisted selection QTL, quantitative trait locus RAPD, random amplified polymorphic DNA SCAR, sequence characterized amplified region SSR, simple sequence repeat
 |
INTRODUCTION
|
|---|
COTTON FIBER is an important raw material for the textile industry. As a result of the recent advances in the textile industry in spinning technology, greater cotton fiber quality, especially strength, is required (Deussen, 1992). Because of the rigors of ginning, opening, cleaning, carding, combing, and drafting, an important breeding objective has been to increase fiber strength. Fiber strength in Upland cotton grown in the USA has been increased by 0.19 cN tex-1 yr-1 over the 10-yr period of 1982 to 1992. The average strength of the commercial cultivars in 1991 to 1992 was close to 21.7cN tex-1 (Benedict et al., 1999). There is an urgent need to improve cotton fiber quality further. However, there is no rapid way to do this by current plant breeding methods and on the basis of current genetic information. In traditional breeding to develop super quality fiber properties, the quality of the fiber can be determined only after harvesting and testing the fiber. As a result, it is difficult, expensive, and time-consuming to develop cotton cultivars with super quality fiber by these methods.
Advances in the use of DNA markers for MAS provide a promising method of streamlining plant breeding programs (Kohel et al., 2001; Lawson et al., 1997; Mohan et al., 1997). In 1999-2000, we used a G. anomalum Wawra ex Wawra & Peyritch introgression line 7235, which had been determined to possess good fiber quality, to identify molecular markers linked to fiber strength QTLs. By use of F2 and F2:3 populations derived from a cross between 7235 and TM-1, a widely used genetic standard of Upland cottons, a major QTL for fiber strength was identified. Eight molecular markers, two SSRs and six RAPDs, covering 15.6 centimorgans (cM) of genetic distance, were linked to this QTL. It could explain more than 30% of the phenotypic variation. The QTL was detected in different locations, such as Nanjing and Hainan in China, and College Station, TX, in the USA. Therefore, these DNA markers can be used in MAS to increase fiber strength of commercial cultivars (Zhang et al., 2003).
RAPD technology has the shortcoming of relatively low reproducibility and reliability, which limits its use in breeding program, whereas molecular markers based on polymerase chain reaction (PCR) technology should be an efficient means of screening large populations, and they are relatively easy analyze, can be screened at with reproducibility, and are economical. Paran and Michelmore (1993) described a reliable PCR assay that they called sequence characterized amplified regions (SCARs) in which the two ends of the polymorphic DNA fragment are sequenced and two longer primers homologous to each end are then synthesized. Some SCAR markers have been developed for insect and disease resistance and fertility restoration genes (Nair et al., 1995; Nair et al., 1996; Nagvi and Chatto, 1996; Ohmori et al., 1996; Norio, 1997; Liu et al., 1999). These SCAR markers increased reliability and specificity for screening large breeding populations by means of the converted molecular markers for assisting breeding selection. The objective of this study was to develop SCAR markers for molecular identification of the high fiber strength QTL that we identified and to use such markers to select the high fiber strength QTL in cotton breeding programs.
 |
MATERIALS AND METHODS
|
|---|
Plant Materials
Gossypium anomalum introgression germplasm lines were developed by crossing G. anomalum with G. hirsutum, and then backcrossing to cultivars and strains with high fiber strength, such as Acala 3080, PD 8619, and PD 4381. The germplasm line 7235 was developed from a backcrossed progeny with Acala 3080 (Qian et al., 1992). The fiber strength of 7235 was 27.3 cN tex-1, its fiber length was 35 mm, and its fineness was 4.1 Micronaire units, and it was grown at Nanjing in 1998. TM-1, the genetic standard line for Upland cotton (Kohel et al., 1970), was obtained from USDA ARS, Southern Plains Agriculture Research Center, College Station, TX, USA. Its fiber strength was 20.7 cN tex-1, its length was 30.5 mm, its fiber fineness was 5.0 Micronaire units, and it was grown at Nanjing in 1998.
The same (7235 x TM-1) F2 population that was used for the tagging QTLs for fiber qualities (Zhang et al., 2003) was also used to identify the consistency of the objective marker after using UBC4311920 and SCAR4311920 to screen separately. To transfer the superior fiber quality gene from 7235 to commercial cultivars, Simian 3 (SM 3) in Yantze River valley was crossed with 7235. From (7235 x SM 3) BC1F1 to (7235 x SM 3) BC1F4 generations, individual plants were selected on the basis of fiber quality detection results. Individual plants selected from (7235 x SM 3) BC1F4 population were planted into families at the Jiangpu Breeding Station and Nanjing Agricultural University in 2000. Individual plants that were used to test the genetic stability of the QTL and its MAS result ranged from 5 to 8 in each family. All the cotton fiber from each individual plant from (7235 x SM 3) BC1F4 was harvested for the fiber tests. Fiber samples were tested by Supervision, Inspection & Test Center of Cotton Quality, the Ministry of Agriculture, China. The difference in the fiber quality of the individual plants with and without the molecular marker in this advanced backcrossing/selfing population was determined by the t test.
DNA Analysis
Total DNA was extracted from a healthy leaf of each of the (TM-1 x 7235) F2 plants in the breeding population by the cetyltrimethylammonium bromide (CTAB) method (Paterson et al., 1993) with minor modifications in the elimination of diethyldithiocarbamic acid. Following a single chloroform-isoamyl alcohol (24:1) extraction, the precipitated DNA was resuspended in sterile TE for amplification by PCR.
All PCR amplifications were performed in 20-µL volumes in a Perkin-Elmer 9600 Thermocycler (Foster City, CA). RAPD experiments included 45 cycles of amplification (at 95°C for 30 s, at 40°C for 1 min, at 72°C for 1.5 min after an initial denaturing step at 95°C for 2 min), performed in a 25-µL reaction volume containing 0.5 units Taq DNA polymerase (Sigma, St. Louis, MO), a buffer (100 mM Tris-HCl, pH 8.3, 500 mM KCl), a 0.5 µM primer, 100 µM dNTP (dATP, dTTP, dGTP, dCTP), and 3.5 mM of MgCl2 supplied by the enzyme manufacturer. PCR products were separated in 1.4% (w/v) agarose gels and visualized under UV light after ethidium bromide staining. SSR reactions contained 67 mM/L of Tris-HCL (pH 8.8), 16 mM/L of (NH4)2SO4, 0.002% (w/v) gelatin, 0.2 mM/L dNTPs, 2.5 mM/L of MgCl2, F-primer and R-primer (Research Genetics, Huntsville, AL) 0.6µM/L separately, 0.25U of Taq DNA polymerase (Sangon Company, Shanghai) and a template DNA of 20 ng. The amplification was programmed at 95°C for 2 min, followed by 30 cycles at 94°C for 40 s, then at 57°C for 45 s and then at 72°C for 1min, with a final extension at 72°C for 7 min. PCR products were inspected by means of polyacrylamide gel electrophoresissilver staining. SCAR reactions contained 10 mM of Tris-HCl (pH 8.3), 50 mM of KCl, 2.5 mM of MgCl2, 200 µM of each dNTP, 1 µM of each pair of primers, 20 ng of total DNA, and 1 U of Taq DNA polymerase. The amplification was programmed at 95°C for 2 min, followed by 35 cycles at 94°C for 30 s, then at 58°C for 1min, then at 72°C for 1min 30 s, with a final extension at 72°C for 10 min. PCR products were separated on a 1.0% (w/v) agarose gel.
The 1365- and 1920-basepair (bp) polymorphic RAPD fragments, amplified from 7235 by means of random primer UBC757 (GGAAGGGAGG) and UBC431 (CTGCGGGTCA), were cut from the agarose gel with a clean scalpel and the agarose plug containing the DNA was placed in a 1.5-mL microcentrifuge tube with 100 µL of TE. The samples were heated at 94°C for 15 min to dissolve the agarose, then diluted with TE solution according to different proportion, such as 1:25,1:50, and 1:100 separately, and 1-µL aliquots of each dilution under the same condition described before with the same primers were reamplified. The amplification products were directly ligated to pGEM-T easy vector (Promega, Madison, WI, USA) after they were confirmed to be RAPD bands through running gel on 2% (w/v) agarose for each dilution as recommended by the manufacturer. The recombinant vectors were separately used to transform competent Escherichia coli DH5
cells. The different clones, p1365 and p1920, were sequenced on an ABI Prism 377 DNA Sequencer (PE Biosystems, Foster City, CA) after the correct insert size was confirmed by EcoRI digestion. Double-strand sequencing was done by means of the dideoxy-chain termination method with SP6 and T7 universal primers. The sequencing experiment was conducted by Shanghai Sangon Company.
 |
RESULTS
|
|---|
Cloning and Sequencing of UBC4311920 and UBC 7571365
To develop a reliable SCAR marker for the detection of UBC4311920 and UBC7571365, the polymorphic DNA fragments, with 1920- and 1365-bp molecular weights amplified from 7235, were cloned separately into the pGEM-T easy vector. When the inserted DNA from different clones was digested with EcoRI (Fig. 1), it was found that the 1920-bp fragment from UBC431 had an EcoRI restriction site at about 1000 bp from the 5' end of the sequences and that the 1365-bp fragment from UBC757 had no such restriction site. The two different clones, p431-1920 and p757-1365, were sequenced after the correct insert size was confirmed by EcoRI digestion. The sequencing results confirmed that both ends of the cloned fragments were consistent with the 10-base random primers of UBC431 and UBC757.

View larger version (58K):
[in this window]
[in a new window]
|
Fig. 1. EcoRI digestion of the recombinant clones. Lane 1-2: EcoRI digested p757-1365; Lane 3: undigested p757-1365; Lane 4: EcoRI digested p431-1920; Lane 5: undigested p431-1920; and M: Lambda DNA/EcoRI + HindIII.
|
|
Development of SCAR Markers Linked to High Fiber Strength QTLs
On the basis of the sequences of the two ends in p431-1920 and p757-1365, two pairs of 21 to 24 bases long (P1F and P1R, P2F and P2R), which included the original 10 bases of random primer of UBC431 and UBC757, respectively, were designed.
p431-1920F: CTGCGGGTCATGATCTGAAAT
p431-1920R: CTGCGGGTCAAGGATATTATCAG
p757-1365F: GGAAGGGAGGCGTCAATAAAGT
p757-1365R: GGAAGGGAGGGAAAACTATTGG
Primer combination p757-1365F and p757-1365R amplified a 1365-bp DNA fragment not only in high strength parent 7235 and its F1, but also in TM-1, which suggested that the pair of primers could not be used in assisted selection for high strength fiber QTLs. Primer combination p431-1920F and p431-1920R (designated as SCAR431) amplified a 1920-bp DNA fragment only in the donor parent 7235 and its F1, but not in TM-1 (Fig. 2). To identify the consistency of amplification results by primers UBC431 and SCAR431, further investigation was conducted with the same (7235xTM-1) F2 segregation population as was used in the tagging of high strength fiber QTLs (Zhang et al., 2003). In a total of 90 RAPD reactions, 17 (18.9%) yielded no UBC4311920 products, while 73 (81.1%) had the expected result. SCAR431 primer combinations also amplified the same 90 individuals of the (7235xTM-1) F2 population; the results of producing targeted polymorphic bands were nearly 96% consistence with those that used UBC431 primer. The difference is that the products amplified with UBC431 primer were weak, unstable, and difficult to identify (Table 1).

View larger version (85K):
[in this window]
[in a new window]
|
Fig. 2. Development of SCAR markers for UBC7571365 and UBC4311920. Lanes 1, 2, 3, and 4 show products of 7235, TM-1, F1 and p757-1365 amplified with a pair of primer, P2F and P2R; lanes 5,6,7, and 8 show products of 7235, TM-1, F1 and p431-1920 amplified with a pair of primer, P1F and P1R; and M, Lambda DNA/EcoRI + HindIII.
|
|
View this table:
[in this window]
[in a new window]
|
Table 1. Comparison of UBC4311920 and SCAR4311920 markers for the detection of the high strength QTL in (7235xTM-1) F2 population.
|
|
Evaluation of the RAPD, SSR, and SCAR Markers Linked to High Strength Fiber QTLs for Selecting High Strength Plants
On the basis of our having crossed (SM 3x7235) BC1F4 families for transferring high fiber strength QTLs, we selected five to eight individual plants from each family to test the advantage of the SCAR marker over the RAPD markers in the detection of high strength fiber QTLs. This was done to determine the genetic stability of the QTL and its MAS. A total of 164 high strength single plants from (SM 3x7235) BC1F4 derivatives were tested for fiber quality by means of SCAR4311920 and were subjected to the analysis of two RAPD markers (UBC301933 and OPM071047) and one SSR marker (SSR1521130) as a control. SCAR4311920 produced clearly targeted products in the breeding population (Fig. 3). Compared with the result derived from screening with two RAPD primers and one SSR marker (Table 2), the consistency rates, in terms of presence or absence of the targeted product, were 88.4% for UBC301933 and OPM071047, 92.1% for UBC301933 and SCAR4311920, 96.3% for SCAR4311920 and OPM071047, and 92.1% for SCAR4311920 and SSR1521130, respectively. Some crossovers occurred among these three markers. The genetic distance was 6.7 cM between UBC4311920 and OPM071047, 4.0 cM between UBC4311920 and SSR1521130, and 8.9 cM between UBC4311920 and UBC301933, the pair of markers with the most frequent crossovers. The result was consistent with the linkage map shown in Fig. 4. All the individuals having the marker showed high fiber strength. Fiber strength of SM 3, a commercial cultivar, was 22.00cN tex-1 in 2001.

View larger version (115K):
[in this window]
[in a new window]
|
Fig. 3. The amplified results with SCAR4311920 in backcrossing/selfing breeding population M, Lambda DNA/EcoRI + HindIII. Lane 1-4 showed amplification product of 7235, TM-1, F1 and p431-1920; and lanes 5-87 represented different high strength individual plant from (SM 3x7235) BC1F4 families.
|
|

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 4. A chromosome 10 segment showing molecular markers linked to the major QTL for fiber strength in Upland cotton 7235.
|
|
 |
DISCUSSION
|
|---|
Fiber strength is typically a quantitatively inherited trait (see review by May, 1999). Additive gene action predominates and five (Self and Henderson 1954) to as many as 14 (Tipton et al., 1964) genes were found to influence fiber strength. However, some data suggested that fiber strength might not always segregate in a quantitative manner, the inheritance analysis of some introgression lines particularly suggested this. Richmond (1951) indicated that recovery of high strength segregants from small backcross population during introgression of the triple hybrid G. thurberi Todaro x G. arboreum L. x G. hirsutum L. was evidence for only a few major genes controlling fiber strength. Meredith (1977)(1992) came to a similar conclusion. Two further backcrosses were made to Deltapline 16 nectareless to produce a nectariless strain, MD65-11, which had strength about 10% higher than that of Deltapine 16. MD 65-11 was crossed with Deltapine 90 followed by two backcrosses to Deltapine 90 with selection first for nectareless and then for bundle strength. Genetic analysis of variance components suggested that the 9% increase in strength could be conditioned by no more than a single gene. However, subsequent analysis with larger population sizes indicated that two major genes, which might be linked, were responsible for the high strength trait. From our genetic and molecular tagging results, we concluded that the higher fiber strength trait in 7235 was controlled by one major gene and a polygene (Yuan, 2000). Thus, it is feasible that selection by means of the high strength major QTL marker from 7235 will be successful.
Molecular markers are useful in plant breeding because the presence of targeted traits can be detected without waiting for the phenotypic expression of the gene (Ribaut et al., 1997). Furthermore, molecular markers can be used simultaneously to improve lint yield and fiber strength, which has become a major breeding consideration owing to a strong negative association between lint yield and fiber strength. In this study, SCAR4311920 could be used for selecting high strength individual in the segregating population. The genetic stability of a major QTL for fiber strength and its efficiency of MAS were studied in 164 progenies in BC1F4 generations of SM 3x7235 with 7235 as a parent with two RAPD markers, UBC301933 and OPM071047, and a SSR marker, with SSR1521130 as a control. The results revealed that the QTL for fiber strength associated with the four inherited markers steadily advanced in segregating generation populations. The mean difference of fiber strength between individuals with or without these markers did not decrease after several generations of selfing and backcrossing. There was a significant difference, 25.98 and 24.04 cN tex-1, 25.68 and 24.03 cN tex-1, and 26.14 and 23.66 cN tex-1, in the mean of fiber strength with and without SCAR4311920, UBC301933, and OPM071047, respectively. Additionally, the fiber strength means of homozygote plants with and without SSR1521130 marker were 25.94 cN tex-1 and 24.03 cN tex-1. Their difference was significant too. The mean fiber strength of heterozygote identified by SSR marker SSR1521130 was 24.94 cN tex-1. The difference between the heterozygote and other genotypes was not significant (Shen et al., 2001). It was concluded that MAS done to increase fiber strength is only possible with this major QTL, but a SCAR marker that is highly reproducible and economical makes it possible to screen large breeding populations. Furthermore, a SCAR markers based on PCR technology facilitate molecular analysis of marker-assisted breeding selection.
 |
ACKNOWLEDGMENTS
|
|---|
This project was financially supported in part by National Natural Science Foundation in China (30270806, 30070483), the 863 project in China (2001AA211101), the National Transgenic Program in China (J99-A-023), and The Natural Science Foundation of Jiangsu Province (BK99052).
Received for publication August 24, 2001.
 |
REFERENCES
|
|---|
- Benedict, C.R., R.J. Kohel, and H.L. Lewis. 1999. Cotton fiber quality. p. 269288. In WC Smith (ed.) Cotton: Origin, history, technology, and production. John Wiley & Sons, New York.
- Deussen, H. 1992. Improved cotton fiber properties: The textile industry's key to success in global competition. p. 4364. In Proceedings from Cotton Fiber Cellulose: Structure, Function and Utilization Conference. National Cotton Council of America, Memphis, TN.
- Kohel, R.J., T.R. Richmond, and C.F. Lewis. 1970. Texas marker-1. Description of a genetic standard for Gossypium hirsutum L. Crop Sci. 10:670671.[Abstract/Free Full Text]
- Kohel, R.J., J. Yu, Y.-H. Park, and G.R. Lazo 2001. Molecular mapping and characterization of genes controlling fiber quality in cotton. Euphytica 121:163172.[ISI]
- Lawson, D.M., C.F. Lande, and M.A. Mutscher. 1997. Marker-assisted transfer of acylsugar-mediated Pest resistance from the wild tomato Lycopersicon pennelli to the cultivated tomato, Lycopersicon esculentum. Mol. Breed. 3:307317.
- Liu, Z., Q. Sun, Z. Ni, and T. Tang. 1999. Development of SCAR markers linked to the Pm21 gene conferring resistance to powdery mildew in common wheat. Plant Breed. 118:215219.
- May, O.L. 1999. Genetic variation in fiber quality. p.183230. In A.S. Basra (ed.) Cotton fibers, developmental biology, quality improvement and textile processing. Food Products Press, New York.
- Meredith, W.R.J. 1977. Backcross breeding to increase fiber strength of cotton. Crop Sci. 17:172175.[Abstract/Free Full Text]
- Meredith, W.R.J. 1992 Improving fiber strength through genetics and breeding. p. 289302. In Proceedings from Cotton Fiber Cellulose: Structure, Function and Utilization Conference. National Cotton Council of America, Memphis, TN.
- Mohan, M., S. Nair, A. Bhagwat, T.G. Krishna, M. Yano, C.R. Bhatia, and T. Sasaki. 1997. Genome mapping, molecular markers and marker-assisted selection in crop plants. Mol. Breed. 3:87103.
- Nagvi, N.I., and B.B. Chatto. 1996. Development of a sequence characterized amplified region (SCAR) based indirect selection method for a dominant blast-resistance gene in rice. Genome 39:2630.[Medline]
- Nair, S., J.S. Bentur, U.P. Rao, and M. Mohan. 1995. DNA markers tightly linked to a gall midge resistance gene (Gm2) are potentially useful for marker-aided selection in rice breeding. Theor. Appl. Genet. 91:6873.
- Nair, S., A. Kumar, M.N. Srivastava, and M. Mohan. 1996. PCR-based DNA Markers linked to a gall midge resistance gene, Gm4t, has potential for marker-aided selection in rice. Theor. Appl. Genet. 92:660665.
- Norio, I. 1997. A rapid PCR-aided selection of a rice line containing theRf-1 gene which is involved in restoration of the cytoplasmic male sterility. Mol. Breed. 3:195202.
- Ohmori, T., M. Murata, and F. Motoyoshi. 1996. Molecular characterization of RAPD and SCAR markers linked to the Tm-1 locus in tomato. Theor. Appl. Genet. 92:151156.[ISI]
- Paran, I., and R.W. Michelmore. 1993. Development of reliable PCR-based markers linked to downy mildew resistance genes in lettuce. Theor. Appl. Genet. 85:985993.[ISI]
- Paterson, A.H., L. Brubaker, and J. Wendel. 1993. A rapid method for extraction of cotton genomic DNA suitable for RFLP or PCR analysis. Plant Mol. Biol. Rep. 11:122127.
- Qian, S.Y., J.Q Huang., Y.J. Peng, B.L. Zhou, M.C. Ying, D.Z. Shen, G.L.Liu, T.X. Hu, Y.J. Xu, L.M. Gu, W.C. Ni, and S. Chen. 1992. Studies on the hybrid of G.hirsutum L.and G.anomalum Wawr. & Peyr. and application in breeding (in Chinese with English abstract). Scientia Agricultura Sinica 25:4451.
- Ribaut, J.M., X. Hu, and D.A. Hoisington. 1997. Use of STSs and SSRs as rapid and reliable pre-selection tools in a marker-assisted selectionbackcross scheme. Plant Mol. Bio. Rep. 15:154162.
- Richmond, T.R. 1951. Procedures and methods of cotton breeding with special reference to American cultivated species. Adv. Genet. 4:213245.[Medline]
- Self, F.W., and M.T. Henderson. 1954. Inheritance of fiber strength in a cross between the upland cotton varieties AHA50 and Half. Agron. J. 46:151154.[Free Full Text]
- Shen, X.L., Y.L. Yuan, W.Z. Guo, X.F. Zhu, and T.Z. Zhang. 2001. Genetic stability of a major QTL for fiber strength and its marker-assisted selection in upland cotton. High Tech. Lett. 11:1321.
- Tipton, K.W., M.A.A. El-Sharkawy, B.M. Thomas, J.E. Jones, and M.T. Henderson. 1964. Inheritance of fiber strength in two separate crosses of Upland cotton having a common parent. p. 2027. In J.B.Pate (ed.) Proceedings of the Sixteenth Annual Cotton Improvement Conferences. National Cotton Council of America, Memphis, TN.
- Yuan, Y.L. 2000. Inheritance of super fiber quality characters and their molecular tagging in upland cotton (G. hirsutum L.). Ph.D. Diss. Nanjing Agric. Univ., Nanjing, China.
- Zhang, T.Z., Y.L. Yuan, J. Yu, W.Z. Guo, and R.J. Kohel. 2003. Molecular tagging of a major QTL for fiber strength in upland cotton and its marker-assisted selection. Theor. Appl. Genet. 106:262268.[ISI][Medline]
This article has been cited by other articles:

|
 |

|
 |
 
J. Zhang, Y. Lu, R. G. Cantrell, and E. Hughs
Molecular Marker Diversity and Field Performance in Commercial Cotton Cultivars Evaluated in the Southwestern USA
Crop Sci.,
June 24, 2005;
45(4):
1483 - 1490.
[Abstract]
[Full Text]
[PDF]
|
 |
|