Crop Science Journal of Natural Resources and Life Sciences Education
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Belanger, F. C.
Right arrow Articles by Meyer, W. A.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Belanger, F. C.
Right arrow Articles by Meyer, W. A.
Agricola
Right arrow Articles by Belanger, F. C.
Right arrow Articles by Meyer, W. A.
Related Collections
Right arrow Turfgrass
Published in Crop Sci. 43:2172-2176 (2003).
© 2003 Crop Science Society of America
677 S. Segoe Rd., Madison, WI 53711 USA

TURFGRASS SCIENCE

Interspecific Hybridization as a Potential Method for Improvement of Agrostis Species

F. C. Belanger*,a, K. A. Plumleya, P. R. Dayb and W. A. Meyera

a Dep. of Plant Biology and Pathology, Rutgers Univ., New Brunswick, NJ 08901-8520
b Biotechnology Center for Agriculture and the Environment, Rutgers Univ., New Brunswick, NJ 08901-8520

* Corresponding author (belanger{at}aesop.rutgers.edu).


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Some Agrostis spp., such as A. stolonifera L. (creeping bentgrass), A. capillaris L. (colonial bentgrass), and A. canina L. (velvet bentgrass), are commercially important turfgrass species which are used extensively on golf courses. Development of improved cultivars of these species is the focus of many commercial and academic breeding programs. Interspecific hybridization between Agrostis spp. has not yet been utilized in cultivar development. Here we have investigated the frequency of interspecific hybridization between transgenic creeping bentgrass and four related Agrostis spp. using transmission of a herbicide resistance gene as a marker to identify the hybrids. Interspecific hybrids were recovered with all four Agrostis spp. used, although the frequency was lower than the frequency of selfing. The hybrids were found to be fertile. Our results suggest that interspecific hybridization may be a useful approach in future Agrostis breeding, but will benefit from a screening method to distinguish the hybrids from the selfs.

Abbreviations: PCR, polymerase chain reaction


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
INTERSPECIFIC AND INTERGENERIC hybridization between crop species and wild relatives followed by backcrossing is commonly used to introgress desirable genes into the crop (Stalker, 1980). This method has been used in breeding improved cultivars of numerous species (Kalloo, 1992). Such wide hybridization has also been used to generate new crop species, the best known being triticale (Lukaszewski and Gustafson, 1987). Interspecific hybridization has not, however, been widely utilized by turfgrass breeders (Brilman, 2001) and may offer new opportunities for cultivar improvement. In fact, many turfgrass species have evolved through natural interspecific hybridization (Cassler and Duncan, 2003).

Some Agrostis spp. are important turfgrasses and are used extensively on golf courses. Creeping bentgrass is the major species used on golf greens and fairways in temperate climates (Warnke, 2003). Colonial bentgrass and velvet bentgrass are also occasionally used (Brilman, 2003; Ruemmele, 2003). Each species has traits such as susceptibility to particular diseases and to drought and heat stress, which are being addressed in current academic and commercial breeding programs (Meyer and Belanger, 1997). Improvements in some of these traits may be possible through interspecific hybridization.

Hybrids between various Agrostis spp., identified as having intermediate characteristics, have been reported to occur in nature (Stuckey and Banfield, 1946; Bradshaw, 1958; Edgar and Forde, 1991). The most extensive investigation into interspecific hybridization among Agrostis spp. was done in the 1950s by Jones. Hybrids among creeping bentgrass, colonial bentgrass, and A. gigantea Roth (redtop bentgrass) were examined for chromosome pairing at metaphase 1 of meiosis (Jones, 1956a,b,c). Jones proposed a model for genome organization in these Agrostis spp., which is summarized in Table 1. Some Agrostis spp. were considered to be allopolyploids having some ancestral genomes in common.


View this table:
[in this window]
[in a new window]
  		Table 1. Chromosome number and genome organization (from Jones, 1956a,b,c; Nelson, 1985) of the Agrostis spp. used in this study.

 
The previous work established that interspecific hybrids between Agrostis spp. can occur, but there was no information on the frequency of hybridization. Identification of interspecific hybrids relied on subjective assessment of intermediate morphological characteristics and cytological analysis. Current molecular techniques utilizing transgenic plants and molecular markers provide a simpler and more precise method of hybrid identification.

The objective of this study was to investigate the frequency of interspecific hybridization between creeping bentgrass and colonial bentgrass, velvet bentgrass, redtop bentgrass, and dryland bentgrass (A. castellana Boiss. and Reut.) under optimum conditions. Dryland bentgrass and redtop bentgrass are used as low maintenance turfgrasses and seed of both is commercially produced (Brede and Sellmann, 2003). The chromosome numbers of the Agrostis spp. investigated range from 14 to 42 (Table 1; Nelson, 1985). To obtain an assessment of the maximum biological potential for hybridization, flowering times were artificially manipulated and crosses were done under greenhouse conditions. Transgenic creeping bentgrass plants expressing the bar gene (Hartman et al., 1994; Lee et al., 1996), which confers resistance to the herbicide glufosinate [2-amino-4-(hydroxymethylphosphinyl)butanoic acid], were used as the pollen parents. Transfer of the herbicide resistance transgene to progeny harvested from the nontransgenic Agrostis spp. was used to identify hybrids. Here we report on the frequency of hybridization and the fertility of the hybrids recovered.


   MATERIALS AND METHODS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
RESULTS
 DISCUSSION
 REFERENCES
 
Plant Materials
Two lines of transgenic creeping bentgrass plants previously generated by particle bombardment (4475) and protoplast transformation (5061) were used as pollen parents (Hartman et al., 1994; Lee et al., 1996). These transgenic lines were previously found to produce viable pollen and their progeny segregated 1:1 for the bar gene (Lee et al., 1997; Belanger et al., 2003). The plants were clonally propagated in the greenhouse.

Velvet bentgrass seed was from the Western Regional Plant Introduction Station, Pullman, WA (PI 189141). Dryland bentgrass cv. Highland and redtop bentgrass cv. Streaker were from Great Western Seed Company, Albany, OR. Colonial bentgrass was from the Western Regional Plant Introduction Center (PI 171470, PI 172698, PI 252045, PI 494120) and from Seed Research, Inc., Corvallis, OR.

Individual seedlings of the nontransgenic Agrostis spp. were established in the greenhouse. Agrostis spp. require vernalization for flower induction. In July 1997, a nursery plot of the transgenic creeping bentgrass and the nontransgenic Agrostis spp. was established for use in crossing in spring 1998.

Crosses and Screening for Hybrids
There is variation in the seasonal timing of flowering in different species of Agrostis. To ensure that flowers of comparable developmental stages would be available from the various species, flowering was induced in some plants of each species by moving them into a containment greenhouse maintained under long days (18 h). Beginning in April 1998, individual plants of each species were transferred to the containment greenhouse at weekly intervals. The temperature during the day was 18 to 21°C and at night was 15 to 18°C.

For crossing, panicles of unopened flowers of a transgenic and nontransgenic plant of similar developmental stage were enclosed in bags constructed from interfacing material obtained from a local fabric store. Only the panicles from the nontransgenic parent were harvested. For each cross, the nontransgenic parent plant originated from a single seed and thus represents a unique genotype. Ten to 13 different nontransgenic plants for each species were used in the crosses. By setting up multiple crosses we could be assured of testing the hybridization potential of different genotypes within each species.

Seeds obtained from the crosses were surface sterilized and plated on solidified Murashige and Skoog basal medium (Gibco BRL, Gaithersburg, MD) supplemented with 1 mL L-1 1000X Gamborg's Vitamin Powder (Sigma, St. Louis, MO), 100 mg L-1 myo-inositol (1,2,3,4,5,6-cyclohexanehexol), and 30 g L-1 sucrose (1-alpha-D-glucopyranosyl-2-beta-D-fructofranoside) in 100- by 25-mm Petri dishes. The dishes were placed at 4°C for 1 wk and then moved to a lighted growth chamber at 25°C for germination. When the plants were {approx}2- to 3-cm tall they were transplanted into 96 well flats in the greenhouse.

After {approx}4 wk of establishment in the greenhouse, the plants were sprayed with the commercial herbicide Finale (AgrEvo Environmental Health, Montvale, NJ) at a final concentration of glufosinate of 0.35%. Plants that survived the spray were repotted and maintained in the greenhouse. The surviving plants were later sprayed again to confirm that they were herbicide resistant.

Hybrid Fertility
To assess the fertility of the recovered hybrids, a nursery plot of the hybrids was established in September 1999 to allow vernalization through the winter. In the spring of 2000, three individuals from each hybrid type were transferred from the nursery to 32-cm-diameter plastic pots and open pollinated crossing blocks were established. Each hybrid plant was placed in the center and surrounded by three nontransgenic creeping bentgrass plants and three nontransgenic plants of the other Agrostis parental species. The crossing blocks were spaced 30 feet apart from each other. The design of the crossing blocks was intended to maximize the chance for crossing. All plants for each crossing block were chosen based on having panicles at the same developmental stage. All of the plants were checked and confirmed to be shedding pollen at the same time.

Seed from all plants were harvested individually and screened in the greenhouse for herbicide-resistant progeny. For screening, all the seed obtained from each plant was sown into 28- by 54-cm flats of commercial potting mix (Pro-Mix, Premier Brands Inc., Red Hill, PA). After 3 to 4 wk of growth, the seedlings were sprayed with Finale as described above. Approximately 2 wk after the spray, a representative sample was counted for survivors and dead plants.

Polymerase Chain Reaction Analysis
Polymerase chain reaction (PCR) analysis was used to confirm the presence of the bar gene in some of the interspecific hybrids. DNA was isolated from leaf blades as previously described (Reddy et al., 1996). The primers used were designed to amplify a 446-base-pair region of the bar coding sequence. The primer sequences were 5'TGCACCATCGTCAACCACTACATC3' and 5'AGGCTGAAGTCCAGCTGCCAGAAA3'. Polymerase chain reactions were performed in a total volume of 50 µL. Each reaction contained 1 U of Elongase Enzyme Mix (Life Technologies, Gaithersburg, MD), 20 pmol of each primer, 200 µM deoxynucleotide triphosphates, 1.4 mM MgCl2, and 100 ng of total genomic DNA. Polymerase chain reaction cycling parameters were 35 cycles of 30-s denaturation at 94°C, 45-s annealing at 60°C, and 120-s extension at 68°C. Polymerase chain reaction products were analyzed by electrophoresis in 1% (w/v) agarose gels.


   RESULTS
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
DISCUSSION
 REFERENCES
 
Self Fertility in Agrostis spp.
Agrostis species are generally considered to be self incompatible, although there is a low level of selfing. Therefore, most seed produced from a plant originates from fertilization from pollen from another individual. To assess the potential for self-fertility in the Agrostis species used in this study, unopened panicles from an individual plant were bagged together. Table 2 presents the data obtained regarding self-fertility in the four Agrostis spp. Low numbers of plants were recovered for all four species. Self-fertilization can therefore occur in these species, but at a low frequency. The number of florets per panicle can vary considerably, but is generally >100. On the basis of such a conservative estimate of potential seed set, the frequency of selfing observed ranged from 0.2 to 0.5%.


View this table:
[in this window]
[in a new window]
  		Table 2. Summary of number of plants recovered following self-fertilization in Agrostis spp.

 
Interspecific Hybridization of Creeping Bentgrass
Table 3 summarizes the results of the crosses between the transgenic creeping bentgrass plants and velvet bentgrass, dryland bentgrass, redtop bentgrass, and colonial bentgrass. Transgenic interspecific hybrids were recovered from all four Agrostis spp. Both transgenic lines resulted in interspecific hybrids with all four species, with the exception of dryland bentgrass where no hybrids were recovered when transgenic line 4475 was the pollen parent.


View this table:
[in this window]
[in a new window]
  		Table 3. Summary of interspecific hybrids recovered from crosses between transgenic creeping bentgrass and four related Agrostis spp. The data presented are from the nontransgenic parents only.

 
Overall, however, low numbers of progeny were obtained. In all cases, the number of herbicide-resistant progeny was considerably lower than the expected 50%, suggesting that many of the plants obtained from those crosses originated from self fertilization rather than interspecific hybridization. Although herbicide-resistant hybrids were recovered from all four species tested, in some of the individual crosses no hybrids were obtained. This suggests there is variation in capacity for interspecific hybridization with creeping bentgrass among individuals within each of the four related Agrostis spp.

The transgenic hybrids were identified as plants that survived two rounds of spraying with glufosinate. To confirm the presence of the bar gene, DNA was isolated from randomly selected hybrid individuals and subjected to PCR analysis. The herbicide-resistant phenotype of the hybrids was correlated with the presence of the bar gene for all samples tested (Fig. 1). No amplification was detected in nontransgenic plants of the four Agrostis spp. used. (Fig. 1A, lanes 7–10).



View larger version (44K):
[in this window]
[in a new window]
  		Fig. 1. Polymerase chain reaction amplification of the 446-base-pair (bp) bar gene coding sequence fragment. A. Interspecific hybrids originating from crosses with creeping bentgrass transgenic line 5061. Lane 1, 100-bp marker; lane 2, creeping bentgrass transgenic line 5061; lane 3, colonial bentgrass hybrid; lane 4, velvet bentgrass hybrid; lane 5, dryland bentgrass hybrid; lane 6, redtop bentgrass hybrid; lane 7, nontransgenic colonial bentgrass; lane 8, nontransgenic velvet bentgrass; lane 9, nontransgenic dryland bentgrass; lane 10, nontransgenic redtop bentgrass. B. Interspecific hybrids originating from crosses with creeping bentgrass transgenic line 4475. Lane 1, 100-bp marker; lane 2, creeping bentgrass transgenic line 4475; lane 3, colonial bentgrass hybrid; lane 4, velvet bentgrass hybrid; lane 5, redtop bentgrass hybrid; lane 6, no DNA control. The numbers to the left of the markers indicate the sizes of the marker bands in bp.

 
Fertility of the Herbicide-Resistant Interspecific Hybrids
In order for interspecific hybridization to be useful in a breeding program, the primary hybrids must have some level of fertility. Three open-pollinated crossing blocks were established for each hybrid class to assess the potential for fertility of the hybrids. Progeny from the hybrids and from each nontransgenic plant in the crossing blocks were screened for herbicide resistance. Table 4 summarizes the results obtained from the crossing blocks.


View this table:
[in this window]
[in a new window]
  		Table 4. Fertility of transgenic interspecific hybrids as assessed by recovery of herbicide-resistant progeny in crossing blocks containing nontransgenic plants of both parental species. The data from the three crossing blocks of each class of interspecific hybrid are combined. The data presented are the total number of glufosinate-susceptible and -resistant progeny recovered from the three interspecific hybrids, the nine nontransgenic creeping bentgrass plants, and the nine nontransgenic plants of the other parental species. The ranges are given in parentheses.

 
Recovery of progeny from all of the hybrids themselves indicates fertility through the egg. There was, however, considerable plant-to-plant variation in number of progeny recovered. Pollen from both parental species was available to the hybrids so we do not know if there was any preference in pollination of the hybrids by either of the parental species. Progeny from the transgenic hybrids segregated with ratios ranging between 1:1 to 1:6 (herbicide-susceptible:herbicide-resistant). A ratio of 1:1 might be expected if most of the progeny originated from pollination from one of the nontransgenic parental species. It may be that in some of the hybrid plants self-incompatibility has broken down, thus resulting in higher frequencies of herbicide-resistant progeny from selfing. Alternatively, there may be distortions in segregation ratios during meiosis because of an unbalanced complement of chromosomes. Another possibility is that some of the hybrids may have been preferentially pollinated by transgenic pollen from other transgenic hybrids in other crossing blocks (at least 30 feet away), rather than the pollen from the nontransgenic plants adjacent to them (inches away).

The recovery of herbicide-resistant progeny from the nontransgenic plants in the crossing blocks indicated pollination from the central transgenic hybrid plant. As expected, pollination of the nontransgenic plants in the crossing blocks was mainly from other nontransgenic plants of the same species, so most of the progeny harvested from them were not herbicide resistant. There was variation in the ability of the different hybrid types to pollinate their parental species. All four hybrid types were capable of backcrossing to creeping bentgrass. The hybrids between creeping bentgrass and velvet bentgrass or dryland bentgrass did not, however, backcross readily with velvet bentgrass or dryland bentgrass, respectively. The hybrids between creeping bentgrass and colonial bentgrass or redtop bentgrass did backcross readily to both parental species.

Overall, the results indicate all the transgenic hybrids tested had some level of fertility, both through the egg and the pollen, but there was considerable variation in the potential for crossing. In addition to the variation observed in fertility among the hybrid types, there was variation in fertility among the hybrids within each type. The objective of the crossing blocks was to determine if the hybrids had any fertility, not to compare their level of fertility with that of the parental species. Such comparisons, as well as assessments of self-compatibility and levels of backcrossing, will need to be determined from controlled crosses. However, the data presented here show that the Agrostis hybrids can be fertile and that they can be backcrossed to the parental species. For future use of interspecific hybridization in Agrostis breeding programs, a herbicide-resistance gene will be a useful tool in hybrid identification.


   DISCUSSION
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
REFERENCES
 
The data reported here indicate that interspecific hybridization could be used in Agrostis breeding programs. Hybrids between creeping bentgrass and velvet bentgrass, colonial bentgrass, dryland bentgrass, and redtop bentgrass were recovered and were fertile to varying degrees. In our study, flowering times were artificially manipulated in the greenhouse to have plants at the same developmental stages for crossing. Clearly, all four Agrostis species tested are biologically capable of hybridizing with creeping bentgrass. The frequency of hybridization was, however, quite low for all four species. Most of the progeny obtained from the crosses performed were actually selfs from the nontransgenic parent rather than interspecific hybrids. Our data indicates that the frequency of interspecific hybridization is similar to or lower than the frequency of selfing. On the basis of isozyme analysis, no selfing was observed in some bentgrass crosses (Warnke et al., 1998). In those cases, there was pollen available for outcrossing, which may have outcompeted any self-pollination. In the study reported here, where there was no pollen available for outcrossing, self pollination and interspecific hybridization occurred at similar frequencies.

In a companion study investigating the potential for interspecific hybridization of transgenic creeping bentgrass under field conditions, a low level of hybrids was recovered from colonial bentgrass and dryland bentgrass (Belanger et al., 2003). No hybrids were recovered with velvet bentgrass or redtop bentgrass. This is certainly because of the fact that, under field conditions, there was no overlap in flowering time between the creeping bentgrass and these two species. Wipff and Fricker (2001) reported a similar low recovery of interspecific hybrids of creeping bentgrass with other Agrostis spp. under open-pollinated conditions.

Our data emphasize the importance of a selection method for identification of any hybrids produced. An easily screenable phenotype, such as the herbicide resistance trait used here, makes hybrid identification simple. Other methods could also be used, such as the development of molecular markers specific for either parent. Progeny from interspecific crosses could then be screened by PCR to identify hybrids and eliminate selfs.

Although interspecific hybridization between creeping bentgrass and other Agrostis spp. occurs at low frequencies, it may be a useful new method that could be implemented in Agrostis breeding programs. Creeping bentgrass is generally quite susceptible to the fungal disease dollar spot caused by Sclerotinia homoeocarpa F.T. Bennett, whereas colonial bentgrass has good resistance (Plumley et al., 2000). Conversely, colonial bentgrass generally is quite susceptible to brown patch (Rhizoctonia solani Kühn), whereas creeping bentgrass has good resistance. Interspecific hybridization between creeping bentgrass and colonial bentgrass and backcrossing to each parental species may be a way of improving the disease resistance of both species. These two species have the same chromosome number, which may make introgression of the desirable genes from interspecific hybrids feasible. In a field test, some of the hybrids recovered between creeping bentgrass and colonial bentgrass were found to have excellent dollar spot resistance (Belanger, Bonos, and Meyer, 2002, unpublished data). Such dollar-spot-resistant hybrids may offer opportunities for cultivar improvement through gene introgression and for identification of the resistance genes involved.


   ACKNOWLEDGMENTS
 
We thank Polina Kogan and Cindy Laramore for excellent assistance. This work was supported by funds from the United States Department of Agriculture/IR4.

Received for publication August 1, 2002.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 




This article has been cited by other articles:


Home page
 J. Environ. Qual.Home page
T. W. Bae, E. Vanjildorj, S. Y. Song, S. Nishiguchi, S. S. Yang, I. J. Song, T. Chandrasekhar, T. W. Kang, J. I. Kim, Y. J. Koh, et al.
Environmental Risk Assessment of Genetically Engineered Herbicide-Tolerant Zoysia japonica
J. Environ. Qual., January 4, 2008; 37(1): 207 - 218.
[Abstract] [Full Text] [PDF]

Home page
 Plant Physiol.Home page
H. M. Li, D. Rotter, S. A. Bonos, W. A. Meyer, and F. C. Belanger
Identification of a Gene in the Process of Being Lost from the Genus Agrostis
Plant Physiology, August 1, 2005; 138(4): 2386 - 2395.
[Abstract] [Full Text] [PDF]

Home page
 Crop Sci.Home page
A. B. Hollman, J. C. Stier, M. D. Casler, G. Jung, and L. A. Brilman
Identification of Putative Velvet Bentgrass Clones Using RAPD Markers
Crop Sci., March 28, 2005; 45(3): 923 - 930.
[Abstract] [Full Text] [PDF]

Home page
 Crop Sci.Home page
D. Kopecky, A. J. Lukaszewski, and V. Gibeault
Reduction of Ploidy Level by Androgenesis in Intergeneric Lolium-Festuca Hybrids for Turf Grass Breeding
Crop Sci., January 1, 2005; 45(1): 274 - 281.
[Abstract] [Full Text] [PDF]

Home page
 Crop Sci.Home page
F. C. Belanger, S. Bonos, and W. A. Meyer
Dollar Spot Resistant Hybrids between Creeping Bentgrass and Colonial Bentgrass
Crop Sci., March 1, 2004; 44(2): 581 - 586.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (10)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Belanger, F. C.
Right arrow Articles by Meyer, W. A.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Belanger, F. C.
Right arrow Articles by Meyer, W. A.
Agricola
Right arrow Articles by Belanger, F. C.
Right arrow Articles by Meyer, W. A.
Related Collections
Right arrow Turfgrass

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
The SCI Journals Agronomy Journal Vadose Zone Journal
Journal of Natural Resources
and Life Sciences Education		 Soil Science Society of America Journal
Journal of Plant Registrations Journal of
Environmental Quality		 The Plant Genome