Published in Crop Sci. 43:1833-1838 (2003).
© 2003 Crop Science Society of America
677 S. Segoe Rd., Madison, WI 53711 USA
GENOMICS, MOLECULAR GENETICS & BIOTECHNOLOGY
Three Microsomal Omega-3 Fatty-acid Desaturase Genes Contribute to Soybean Linolenic Acid Levels
K. D. Bilyeu*,a,
L. Palavallib,
D. A. Sleperb and
P. R. Beuselincka
a USDA-ARS, Plant Genetics Research Unit, University of Missouri, Columbia, MO 65211
b Dep. of Agronomy, University of Missouri, Columbia, MO 65211
* Corresponding author (BilyeuK{at}missouri.edu).
 |
ABSTRACT
|
|---|
Three independent genetic loci have been shown to contribute to soybean [Glycine max (L.) Merrill] seed linolenic acid levels, including the well-characterized Fan locus. Linolenic acid is the product of omega-3 fatty-acid desaturase enzyme activity. The objective of this study was to identify and characterize the family of soybean omega-3 fatty-acid desaturase genes and link them to low seed linolenic acid as a tool for the development of molecular markers for low linolenic acid soybean. Using database homology searches and gene cloning, we identified and characterized three soybean microsomal omega-3 fatty-acid desaturase genes that contribute to seed linolenic acid levels. Relative expression was characterized by quantitative real-time RT-PCR (reverse transcriptase-polymerase chain reaction). One of the three genes was predominantly expressed in developing seeds. We determined that the low linolenic acid breeding line A5 (fan fan) contains two of the genes, but is missing the third sequence. Therefore, the Fan locus can be definitively assigned to one of the three microsomal omega-3 fatty-acid desaturase genes present in the soybean genome. Molecular markers for defects in the three genes will enhance soybean programs breeding for low linolenic acid.
Abbreviations: DNTP, deoxyribonucleotide triphosphate mix DTT, dithiothreitol EDTA, ethylenediaminetetraacetic acid EST, expressed sequence tag GMGI, Glycine max gene index Mbp, megabasepairs MW, molecular weight NEG, negative PCR, polymerase chain reaction RT, reverse transcriptase TC, tentative consensus TIGR, The Institute for Genomic Research
 |
INTRODUCTION
|
|---|
MODIFICATION OF THE FATTY-ACID COMPOSITION of soybean seeds to lower linolenic acid (18:3) levels can improve oil stability and flavor, and eliminate the need for hydrogenation (Dutton et al., 1951; Lui and White, 1992). The production of oxidatively stable soybean oil without hydrogenation is of increasing importance because recent studies have linked the consumption of trans fatty acids found in hydrogenated oils with an increased risk for coronary heart disease (Hu et al., 1997). Nonhydrogenated soybean oil has not been thoroughly evaluated with regard to human disease; however, consumption of nonhydrogenated soybean oil was found, in one study, to be associated with a reduced risk of breast cancer (Dai et al., 2002).
Although progress has been made with mutation breeding approaches, achieving significantly low linolenic acid levels has been hampered by the quantitative nature of the trait. At least three independent genetic loci are associated with seed linolenic acid levels, with mutant alleles identified at fan, fan2, fan3, and fanx (Fehr et al., 1992; Rahman and Takagi, 1997; Ross et al., 2000; Wilcox and Cavins, 1987). Multiple alleles at fan have been reported and the locus has been mapped (Brummer et al., 1995; Rahman et al., 1996; Rennie and Tanner, 1991; Stojsin et al., 1998; Wilcox and Cavins, 1987). In the low seed linolenic acid line A5 (Fehr et al., 1992), the fan(A5) locus was shown to be associated with a deletion in an undefined omega-3 fatty-acid desaturase gene (Byrum et al., 1997). Omega-3 fatty-acid desaturases catalyze a third double bond into linoleic acid precursors to produce linolenic acid. Both chloroplast-targeted and microsomal omega-3 fatty-acid desaturases have been identified in plants, but the microsomal enzymes have been shown to be the major contributors to seed linolenic acid levels (Yadav et al., 1993).
The model plant Arabidopsis thaliana (L.) Heynh. contains one gene encoding a microsomal omega-3 fatty-acid desaturase (FAD3) and two chloroplast targeted enzymes (FAD7 and FAD8). Mutation of FAD3 in Arabidopsis reduced seed linolenic acid levels to 3% from a wild-type level of 16% of total oil (Yadav et al., 1993). The soybean genome is more complex than that of Arabidopsis: the haploid soybean genome is estimated to be 1115 Mbp (megabasepairs) and is comprised of 20 chromosomes (Arumuganathan and Earle, 1991). Additionally, there is evidence for a genome wide duplication in an ancestor of soybean (Shoemaker et al., 1996). The recognition of soybean as an important crop, plus the large collection of expressed sequence tags (ESTs), has made the study of soybean genomics a valuable research area (Shoemaker et al., 2002). The objective of this study was to identify and characterize the family of soybean omega-3 fatty-acid desaturase genes and link them to low seed linolenic acid as a tool for the development of molecular markers for low linolenic acid soybeans.
 |
MATERIALS AND METHODS
|
|---|
Database Searching and Sequence Identification
Both the GenBank (Benson et al., 2002) and TIGR (The Institute for Genomic Research) soybean gene index [GMGI 9 (Glycine max gene index) version 9.0, http://www.tigr.org/tdb/tgi/gmgi/; verified 2 April 2003] databases were used for Blast searches of soybean sequences with AtFAD3 (GenBank accession number D26508) as a query. The TIGR database separated the homologous ESTs into two tentative consensus (TC) sequences for the microsomal omega-3 fatty-acid desaturases. Three separate genes could be predicted from the collected ESTs of the two TC entries using an increased stringency for nucleotide identity and overlap. Oligonucleotide primers were designed specific for each of the three predicted soybean genes and used to amplify the coding sequences from Pana soybean (Nickell et al., 1998).
RNA Isolation, Reverse Transcriptase Reactions, and Quantitative Real-Time PCR
Total RNA was isolated from powdered Williams 82 soybean (Bernard and Cremeens, 1988) or Pana soybean tissues by means of Trizol1 or Concert Plant RNA Reagent (Invitrogen, Carlsbad, CA) following the manufacturer's instructions. RNA samples (15 µg) were vacuum dried and used for RT (reverse transcriptase) reactions. Following a DNaseI treatment in the supplied SuperscriptII (Invitrogen, Carlsbad, CA) buffer (50 mM Tris-HCl, pH 8.3, 75 mM KCl, 3 mM MgCl2), oligo-dT(20) primers (500 ng) were added and the solution was heated to 70°C for 10 min. Samples were put directly on ice and cooled before a brief centrifugation step followed by incubation at 42°C. Prewarmed reaction buffer containing DTT (dithiothreitol, 5 mM final) and dNTPs (deoxyribonucleotide triphosphate mix, 0.5 mM final) was added. SuperscriptII RT (200 U) (Invitrogen, Carlsbad, CA) was added to positive reactions, while water was substituted for enzyme in negative control reactions, and samples were incubated for 50 min at 42°C. Reactions were stopped by incubating samples at 75°C for 15 min.
Soybean tissue cDNA samples were used as templates for quantitative RT-PCR. Reactions were assembled for each template sample without primers and aliquoted into four reaction tubes; primers for GmFAD3A (AGCGACACAAGCAGCAAAAT and GTCTCGGTGCGAGTGAAGGT), GmFAD3B (CCCACCCAGTGAGAGAAAA and AGCACTAGAAGTGGACTAGTTATGAAT), GmFAD3C (CTCAGAAATCTGGGCCATTG and TCGCTAACGAAGTGATCCTGA), or the housekeeping gene EF1 (elongation factor 1
, CTGTAACAAGATGGATGCCACTAC and CAGTCAAGGTTRGTGGACCT) were added to the reactions. At least three independent cDNA samples from each tissue were analyzed by means of the four primer sets. The reaction mix consisted of 1x QuantiTect SYBR Green PCR master mix (Qiagen, Valencia, CA), cDNA templates, and 0.5 µM each primer. Reactions were run on a DNA Engine Opticon 2 System (MJ Research, Waltham, MA) set to detect SYBR green fluorescence. The experimental conditions were 95°C for 15 min, then 35 cycles of 95°C for 20 s, 62°C for 20 s, 72°C for 20 s, and a plate reading. When cycling was completed, the products were characterized by melting-curve analysis and were cloned and sequenced to confirm the specificity of the amplification. Negative control reactions failed to produce products. After subtracting background fluorescence, the cycle at which the fluorescence exceeded the 0.010 threshold limit (cycle threshold) was determined for each sample. Cycle threshold measurements were mathematically converted into genome equivalents by application of the standard curves generated with serial dilutions of soybean genomic DNA and the four primer sets. For each cDNA sample, the expression levels of the three soybean FAD3 genes were normalized as a percent of the EF1 gene expression level.
Soybean FAD3 Gene Amplification, Cloning, and Sequence Analysis
cDNA samples from Pana soybean leaves were prepared as described above and used as templates in PCR amplifications. Reactions for PCR were in a standard buffer (20 mM Tris-HCl, pH 8.4, 50 mM KCl, 1.5 mM MgCl2, 200 µM dNTPs, 0.5 µM each primer, 0.11U Taq polymerase (Roche Applied Science, Indianapolis, IN) or Advantage Taq polymerase (Clontech, Palo Alto, CA). Thermocycling conditions were 95°C for 5 min, 35 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 90 s, followed by 72°C for 4 min. Amplification products were resolved on 1.5% (w/v) agarose gels, cut out, isolated, and cloned into the pCR2.1 TOPO vector (Invitrogen, Carlsbad, CA) for sequencing.
DNA sequence identities for the coding regions of the soybean omega-3 fatty-acid desaturase genes were calculated by PipMaker software as described by Schwartz et al. (2000). The only full-length cDNA sequence encoding a chloroplast-targeted enzyme present in the GenBank, GmL22965 (Yadav et al., 1993), was used as a representative sequence to compare with the microsomal omega-3 fatty-acid desaturase genes.
Amplification of Genomic DNA
Genomic DNA was prepared from powdered whole seedlings of A5 and leaves of Williams 82 soybean. Approximately 1 g of frozen tissue was extracted with 8 mL of acetone. After pelleting the tissue and removal of the acetone, 5 mL of urea extraction buffer [(7 M urea, 31 mM NaCl, 50 mM Tris-HCl, pH 8, 50 mM EDTA (ethylenediaminetetraacetic acid), and 1% (w/v) sarcosyl)] were mixed with the samples. Phenol chloroform and chloroform extractions were followed by addition of 0.5 mL 3 M sodium acetate, pH 5, and 5 mL 2-propanol. Genomic DNA was spooled out. Following an RNase A treatment of the samples, phenol chloroform and chloroform extractions were performed. Samples of DNA were precipitated as above with the addition of sodium acetate and 2-propanol, washed with 70% (v/v) ethanol, and air dried. Samples were resuspended in water at 50 ng µL-1. Primers were designed for GmFAD3A (AATAATGGATACCAAAAGGAAGC and AGCAATTACAAGCACATCC), GmFAD3B (GTTCTTCTTTTGATTTTGATCCTAGC and AGCAATTACAAGCACATCC), and GmFAD3C (GTCCTTTGTTGAACAGCATT and TTCATCCTTCTCAACATGGC). Amplification reactions contained 50 ng of DNA, 0.5 µM of each primer, and 1x QuantiTect SYBR Green PCR master mix. Amplification reactions were run as described above for quantitative RT-PCR, except that 40 cycles were performed. Amplification products were resolved on 1.5% (w/v) agarose gels.
 |
RESULTS
|
|---|
Identification of Soybean Omega-3 Fatty-Acid Desaturases
The Arabidopsis FAD3 protein sequence for the microsomal omega-3 fatty-acid desaturase gene (Yadav et al., 1993) was used to query public databases for soybean FAD3 homologs. Besides the soybean FAD3 sequence originally identified by Yadav et al., a second full-length cDNA expressed in immature seeds was present. From the soybean EST project sequences we deduced the presence of both of these soybean FAD3 homologs. In addition, a third FAD3 homolog was identified which was closely related to the original soybean microsomal omega-3 fatty-acid desaturase sequence. We propose naming the soybean microsomal omega-3 fatty-acid desaturase genes GmFAD3A, GmFAD3B, and GmFAD3C for Glycine max FAD3 homolog-x. The query also revealed several soybean sequences that had the highest sequence identities to the nuclear encoded, chloroplast-targeted omega-3 fatty-acid desaturases, such as the Arabidopsis FAD7 and FAD8 genes (Gibson et al., 1994; Iba et al., 1993; McConn et al., 1994; Yadav et al., 1993). The chloroplast-targeted soybean genes were derived from over 40 ESTs and could not be unambiguously assigned to individual genes without further characterization, so the only full-length cDNA present in the databases (GmL22965, Yadav et al., 1993) was chosen as a representative sequence. A phylogenetic tree of amino-acid alignment of the four soybean sequences was generated to compare the Arabidopsis microsomal and chloroplast-targeted omega-3 fatty-acid desaturases (Fig. 1). The soybean sequences lacking an N-terminal chloroplast signal peptide (GmFAD3A, GmFAD3B, and GmFAD3C) were more closely related to each other and the Arabidopsis FAD3 gene, while the representative soybean chloroplast-targeted sequence (GmL22965) grouped with the chloroplast-targeted Arabidopsis genes. The high degree of relatedness between GmFAD3A and GmFAD3B was evident in the phylogram.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 1. Phylogenetic tree of soybean and Arabidopsis omega-3 fatty-acid desaturases. The protein sequences for the soybean and Arabidopsis omega-3 fatty-acid desaturases were subjected to a ClustalW1.8 alignment and Phylip (no bootstrap) phylogenetic tree prediction (Brodsky et al., 1995). The bar represents 0.1 genetic distance units calculated as the average of the pairwise distances. Genes preceded by Gm are from soybean and those preceded by At are from Arabidopsis thaliana. The GenBank accession numbers for the sequences are GmFAD3A (AY204710), GmFAD3B (AY204711 and L22964), GmFAD3C (AY204712 and AB05125), GmL22964 (L22964), AtFAD3 (D26508), AtFAD7 (D14007), and AtFAD8 (L27158).
|
|
The two full-length soybean FAD3 cDNAs present in the databases were derived from different soybean cultivars. While the soybean EST collections were also made from a variety of cultivars, they were predominated by the cultivars Williams and Williams 82. To investigate the presence of three separate microsomal omega-3 fatty-acid desaturase genes in the soybean genome, the coding sequences for the three genes were amplified from cDNA prepared from leaves of Pana soybean (Nickell et al., 1998). The amplified genes were then cloned and sequenced. The sequence data confirmed that three independent genes were isolated. The Pana sequences have been submitted to the GenBank under accession numbers AY204710 for GmFAD3A, AY204711 for GmFAD3B, and AY204712 for GmFAD3C.
The translated protein sequences were subjected to a Clustal W1.8 alignment (Thompson et al., 1994) with the Arabidopsis FAD3 (Fig. 2). The sequences of the three FAD3 genes from Pana were nearly identical to the three genes identified in the sequence databases. A high degree of amino acid identity was evident among the FAD3 proteins, even between Arabidopsis and soybean. As indicated in Table 1, sequence conservation was high among all of the soybean omega-3 fatty-acid desaturase sequences at the DNA level as well, with the highest identity reaching 94% while the least conserved still contained 68% identical DNA sequences.

View larger version (99K):
[in this window]
[in a new window]
|
Fig. 2. Alignment of soybean FAD3 homologs with Arabidopsis FAD3. The open reading frames for the Pana FAD3 homologs were translated and subjected to a ClustalW1.8 alignment with the Arabidopsis FAD3 gene (AtFAD3). Identical amino acid residues are shaded black and similar amino acids are shaded gray.
|
|
View this table:
[in this window]
[in a new window]
|
Table 1. Percent DNA sequence identity for the coding regions of the soybean omega-3 fatty-acid desaturase genes determined on the basis of analysis by PipMaker software.
|
|
Characterizing Soybean FAD3 Gene Expression
An in silico expression analysis was performed with soybean EST sequences which could be assigned to GmFAD3A, GmFAD3B, or GmFAD3C. Expressed sequence tags for the genes were derived from a variety of tissues (Table 2). Only one tissue-specific library produced more than one EST for any of the three genes.
Quantitative RT-PCR was performed on cDNA templates derived from field-grown soybean leaves, flowers, and developing seeds of Williams 82 in reproductive growth stage R5 to determine the relative expression levels of GmFAD3A, GmFAD3B, and GmFAD3C. Relative expression levels of the three soybean FAD3 homologs ranged from 0.1 to 0.5% in leaves and 1 to 2% of the housekeeping gene expression level in flowers, with no significant differences among the genes (Fig. 3). In developing seeds, the expression of the GmFAD3A gene increased to 60% of the housekeeping gene expression level while GmFAD3C was 0.2% and GmFAD3B expression was below the experimental detection limit. There is evidence that both GmFAD3B and GmFAD3C are expressed in developing seeds since these genes have been cloned from that tissue in other cultivars (data not shown and Yadav et al., 1993).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 3. Relative expression of GmFAD3A, GmFAD3B, and GmFAD3C in soybean tissues. Steady state mRNA levels for each gene were quantitated by quantitative PCR following reverse transcription of total RNA from each tissue. The histograms represent the percent of each gene normalized to the housekeeping gene, EF1. Error bars are plus one standard deviation from the mean.
|
|
Assignment of the Fan Locus to GmFAD3A
Three independent genetic loci have been shown in soybean to contribute to the low linolenic acid seed trait (Fehr et al., 1992; Rahman and Takagi, 1997; Ross et al., 2000; Wilcox and Cavins, 1987). The Fan locus has been extensively characterized, and multiple mutant alleles have been identified by means of mutagenesis (Rahman et al., 1996; Rennie and Tanner, 1991; Stojsin et al., 1998; Wilcox and Cavins, 1987). It has previously been shown that the fan allele from the low linolenic acid soybean line A5 is associated with a deletion of an unspecified omega-3 fatty-acid desaturase gene (Byrum et al., 1997). To determine the complement of microsomal fatty-acid desaturase genes present in the soybean line A5, genomic DNA was subjected to PCR amplification of sequences specific to GmFAD3A, GmFAD3B, and GmFAD3C. As shown in Fig. 4, the soybean line A5 is missing sequences corresponding to GmFAD3A. Additional GmFAD3A primer sets also failed to amplify products from A5 genomic DNA, and the products produced from reactions with GmFAD3B primers were sequenced to confirm their identity (data not shown). Thus, the Fan locus corresponds to the GmFAD3A gene. We have identified novel mutations in the GmFAD3A and GmFAD3C genes in a low linolenic acid soybean line that will be described in detail elsewhere.

View larger version (100K):
[in this window]
[in a new window]
|
Fig. 4. Amplification of GmFAD3A, GmFAD3B, and GmFAD3C sequences from Williams 82 and A5 genomic DNA. Genomic DNA (50 ng) was subjected to 40 cycles of PCR amplification with primers specific for GmFAD3A, GmFAD3B, or GmFAD3C and products were separated on an agarose gel. W82 lanes contained template DNA from Williams 82, A5 lines contained template DNA from A5, and NEG (negative) lanes contained water in place of template DNA as a control. The predicted product sizes were 149, 139, and 246 bp for GmFAD3A, GmFAD3B, and GmFAD3C, respectively. Molecular weight (MW) lanes contained 100 bp ladder MW markers.
|
|
 |
DISCUSSION
|
|---|
The relatively high linolenic acid content in the fatty-acid profile of most current soybean cultivars is responsible for oxidative instability and undesirable flavors in the oil (Dutton et al., 1951). Several mutations associated with the quantitative trait for low linolenic acid have been described and oil with lower linolenic acid had improved oxidative stability and flavor (Lui and White, 1992). The biochemistry of linoleic acid production has been shown to be through the action of microsomal and chloroplast-targeted omega-3 fatty-acid desaturase enzymes (reviewed by Ohlrogge and Browse, 1995). The DNA sequence for one of these enzymes was shown to be deleted in the low linolenic soybean line A5, which has an allele of the fan locus (Byrum et al., 1997).
We identified three independent microsomal omega-3 fatty-acid desaturases in soybeans, GmFAD3A, GmFAD3B, and GmFAD3C. The sequence for GmFAD3A had not previously been recognized as a separate gene. Although GmFAD3A and GmFAD3B shared 94% sequence identity in the coding regions, their relative expression patterns were distinct. GmFAD3A was significantly upregulated in developing seeds while GmFAD3B and GmFAD3C levels remained relatively low in that tissue. Multiple, chloroplast-targeted FAD genes that may also influence seed linolenic acid levels were putatively identified in this study, but the corresponding sequences were not cloned or confirmed.
Using the DNA sequence information for the three soybean FAD3 homologs, we determined the identity of the fan locus in the low linolenic line A5. GmFAD3A sequences were missing in A5 genomic DNA. The major locus (Fan) controlling seed linolenic acid levels corresponded to the gene that was up-regulated relative to the other two genes in developing seeds of Williams 82. Our objective was to identify and characterize the family of soybean omega-3 fatty-acid desaturase genes and link them to low seed linolenic acid as a tool for the development of molecular markers for low linolenic acid soybeans. Molecular markers for the fan(A5) allele assayed by the presence or absence of GmFAD3A sequences can be used in breeding programs for genotyping progeny crossed with A5 or its derivatives (soybean lines A16, A17, and A29).
Independent fan alleles have been shown to reduce seed linolenic acid levels to 2.5 to 5.1% of total fatty acids (Rahman et al., 1996; Stojsin et al., 1998; Wilcox and Cavins, 1985). Other loci such as fan2 and fan3 make less significant contributions to low seed linolenic acid levels, but in combination with fan, can lower seed linolenic acid levels below 2% (Ross et al., 2000). Breeding for incorporation of recessive alleles at three independent loci for a trait with continuous distributions by phenotypic analysis has obvious drawbacks, especially when stacking the low linolenic acid trait with other desirable traits. The GmFAD3B and GmFAD3C genes were expressed at lower levels in developing seeds. Thus, these genes make excellent candidates to associate with the fan2, fan3, and fanx loci. Since the complete coding sequences for the three soybean microsomal omega-3 fatty-acid desaturase genes have been assembled and are now available in GenBank, it should be possible to search for genetic lesions in GmFAD3B and GmFAD3C in lines with fan2, fan3, or fanx alleles. By screening the soybean FAD3 homologs for mutations, we have developed molecular markers for a low linolenic acid soybean line that contains defects in the GmFAD3A and GmFAD3C genes.
The combination of genotype analysis together with fatty-acid profiling for individual seeds will allow the determination of the contribution of mutations in each gene. The mutant alleles that provide the greatest reduction in seed linolenic acid levels can then be combined and used in a breeding program with the appropriate molecular markers.
 |
NOTES
|
|---|
Contribution of the Missouri Agric. Exp. Stn.
1 Mention of a trademark, vendor, or proprietary product does not constitute a guarantee or warranty of the product by the USDA or the Univ. of Missouri and does not imply its approval to the exclusion of other products or vendors that may also be suitable. 
Received for publication January 13, 2003.
 |
REFERENCES
|
|---|
- Arumuganathan, K., and E.D. Earle. 1991. Nuclear DNA content of some important plant species. Plant Mol. Bio. Rep. 9:208218.
- Benson, D.A., I. Karsch-Mizrachi, D.J. Lipman, J. Ostell, B.A. Rapp, and D.L. Wheeler. 2002. GenBank. Nucleic Acids Res. 30:1720.[Abstract/Free Full Text]
- Bernard, R.L., and C.R. Cremeens. 1988. Registration of Williams 82 soybean. Crop Sci. 28:10271028.[Free Full Text]
- Brodsky, L.I., V.V. Ivanov, Y.L. Kalaydzidis, A.M. Leontovich, V.K. Nikolaev, S.I. Feranchuk, and V.A. Drachev. 1995. Genebee-net-internet-based server for analyzing biopolymers structure. Biochemistry (Moscow) 60:923928.
- Brummer, E.C., A.D. Nickell, J.R. Wilcox, and R.C. Shoemaker. 1995. Mapping the fan locus controlling linolenic acid content in soybean oil. Heredity 86:245247.
- Byrum, J.R., A.J. Kinney, K.L. Stecca, D.J. Grace, and B.W. Diers. 1997. Alteration of the omega-3 fatty-acid desaturase gene is associated with reduced linolenic acid in the A5 soybean genotype. Theor. Appl. Genet. 94:356359.[Web of Science]
- Dai, Q., X.O. Shu, F. Jin, Y.T. Gao, Z.X. Ruan, and W. Zheng. 2002. Consumption of animal foods, cooking methods, and risk of breast cancer. Cancer Epidemiol. Biomarkers Prevent. 11:801808.[Abstract/Free Full Text]
- Dutton, H.J., C.J. Lancaster, C.D. Evans, and J.C. Cowan. 1951. The flavor problem of soybean oil. VIII. Linolenic acid. J. Am. Oil Chem. Soc. 28:115118.[Web of Science]
- Fehr, W.R., G.A. Welke, E.G. Hammond, D.N. Duvick, and S.R. Cianzio. 1992. Inheritance of reduced linolenic acid content in soybean genotypes A16 and A17. Crop Sci. 32:903906.[Abstract/Free Full Text]
- Gibson, S., V. Arondel, K. Iba, and C. Somerville. 1994. Cloning of a temperature-regulated gene encoding a chloroplast omega-3 desaturase from Arabidopsis thaliana. Plant Physiol. 106:16151621.[Abstract]
- Hu, F.B., M.J. Stampfer, J.E. Manson, E. Rimm, G.A. Colditz, B.A. Rosner, C.H. Hennekens, and W.C. Willett. 1997. Dietary fat intake and the risk of coronary heart disease in women. N. Engl. J. Med. 337:14911499.[Abstract/Free Full Text]
- Iba, K., S. Gibson, T. Nishiuchi, T. Fuse, M. Nishimura, V. Arondel, S. Hugly, and C. Somerville. 1993. A gene encoding a chloroplast omega-3 fatty-acid desaturase complements alterations in fatty-acid desaturation and chloroplast copy number of the fad7 mutant of Arabidopsis thaliana. J. Biol. Chem. 268:2409924105.[Abstract/Free Full Text]
- Lui, H.R., and P.J. White. 1992. Oxidative stability of soybean oils with altered fatty-acid compositions. J. Am. Oil Chem. Soc. 69:528532.[Web of Science]
- McConn, M., S. Hugly, J. Browse, and C. Somerville. 1994. A mutation at the fad8 locus of Arabidopsis identifies a second chloroplast omega-3 desaturase. Plant Physiol. 106:16091614.[Abstract]
- Nickell, C.D., G.R. Noel, T.R. Cary, and D.J. Thomas. 1998. Registration of Pana soybean. Crop Sci. 38:1399.[Free Full Text]
- Ohlrogge, J., and J. Browse. 1995. Lipid biosynthesis. Plant Cell 7:957970.[Web of Science][Medline]
- Rahman, S.M., and Y. Takagi. 1997. Inheritance of reduced linolenic acid content in soybean seed oil. Theor. Appl. Genet. 94:299302.[Web of Science]
- Rahman, S.M., Y. Takagi, and T. Kumamaru. 1996. Low linolenate sources at the fan locus in soybean lines M-5 and IL-8. Breed. Sci. 46:155158.
- Rennie, B.D., and J.W. Tanner. 1991. New allele at the fan locus in the soybean line A5. Crop Sci. 31:297301.[Abstract/Free Full Text]
- Ross, A.J., W.R. Fehr, G.A. Welke, and S.R. Cianzio. 2000. Agronomic and seed traits of 1%-linolenate soybean genotypes. Crop Sci. 40:383386.[Abstract/Free Full Text]
- Shoemaker, R., P. Keim, L. Vodkin, E. Retzel, S.W. Clifton, R. Waterston, D. Smoller, V. Coryell, A. Khanna, J. Erpelding, X.W. Gai, V. Brendel, C. Raph-Schmidt, E.G. Shoop, C.J. Vielweber, M. Schmatz, D. Pape, Y. Bowers, B. Theising, J. Martin, M. Dante, T. Wylie, and C. Granger. 2002. A compilation of soybean ESTs: Generation and analysis. Genome 45:329338.[Medline]
- Shoemaker, R.C., K. Polzin, J. Labate, J. Specht, E.C. Brummer, T. Olson, N. Young, V. Concibido, J. Wilcox, J.P. Tamulonis, G. Kochert, and H.R. Boerma. 1996. Genome duplication in soybean (Glycine subgenus soja). Genetics 144:329338.[Abstract]
- Stojsin, D., B.M. Luzzi, G.R. Ablett, and J.W. Tanner. 1998. Inheritance of low linolenic acid level in the soybean line RG10. Crop Sci. 38:14411444.[Abstract/Free Full Text]
- Schwartz, S., Z. Zhang, K.A. Frazer, A. Smit, C. Riemer, J. Bouck, R. Gibbs, R. Hardison, and W. Miller. 2000. PipMakerA web server for aligning two genomic DNA sequences. Genome Res. 10:577586.[Abstract/Free Full Text]
- Thompson, J.D., D.G. Higgins, and T.J. Gibson. 1994. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22:46734680.[Abstract/Free Full Text]
- Wilcox, J.R., and J.F. Cavins. 1985. Inheritance of low linolenic acid content of the seed oil of a mutant in Glycine max. Theor. Appl. Genet. 71:7478.[Web of Science]
- Wilcox, J.R., and J.F. Cavins. 1987. Gene symbol assigned for linolenic acid mutant in the soybean. Heredity 78:410.
- Yadav, N.S., A. Wierzbicki, M. Aegerter, C.S. Caster, L. Perez-Grau, A.J. Kinney, W.D. Hitz, J.R. Booth, Jr., B. Schweiger, and K.L. Stecca. 1993. Cloning of higher plant omega-3 fatty-acid desaturases. Plant Physiol. 103:467476.[Abstract]
This article has been cited by other articles:

|
 |

|
 |
 
E. Bachlava, R. E. Dewey, J. W. Burton, and A. J. Cardinal
Mapping and Comparison of Quantitative Trait Loci for Oleic Acid Seed Content in Two Segregating Soybean Populations
Crop Sci.,
March 17, 2009;
49(2):
433 - 442.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Zhang, J. W. Burton, R. G. Upchurch, E. Whittle, J. Shanklin, and R. E. Dewey
Mutations in a {Delta}9-Stearoyl-ACP-Desaturase Gene Are Associated with Enhanced Stearic Acid Levels in Soybean Seeds
Crop Sci.,
November 24, 2008;
48(6):
2305 - 2313.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. R. Fehr
Breeding for Modified Fatty Acid Composition in Soybean
Crop Sci.,
December 18, 2007;
47(Supplement_3):
S-72 - S-87.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. E. Byfield and R. G. Upchurch
Effect of Temperature on Microsomal Omega-3 Linoleate Desaturase Gene Expression and Linolenic Acid Content in Developing Soybean Seeds
Crop Sci.,
November 7, 2007;
47(6):
2445 - 2452.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. S. Chappell and K. D. Bilyeu
The Low Linolenic Acid Soybean Line PI 361088B Contains a Novel GmFAD3A Mutation
Crop Sci.,
July 30, 2007;
47(4):
1705 - 1710.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Cardinal, J. W. Burton, A. M. Camacho-Roger, J. H. Yang, R. F. Wilson, and R. E. Dewey
Molecular Analysis of Soybean Lines with Low Palmitic Acid Content in the Seed Oil
Crop Sci.,
February 6, 2007;
47(1):
304 - 310.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Bilyeu, L. Palavalli, D. A. Sleper, and P. Beuselinck
Molecular Genetic Resources for Development of 1% Linolenic Acid Soybeans
Crop Sci.,
July 25, 2006;
46(5):
1913 - 1918.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. R. Beuselinck, D. A. Sleper, and K. D. Bilyeu
An Assessment of Phenotype Selection for Linolenic Acid Using Genetic Markers
Crop Sci.,
February 24, 2006;
46(2):
747 - 750.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. E. Byfield, H. Xue, and R. G. Upchurch
Two Genes from Soybean Encoding Soluble {Delta}9 Stearoyl-ACP Desaturases
Crop Sci.,
February 24, 2006;
46(2):
840 - 846.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Bilyeu, L. Palavalli, D. Sleper, and P. Beuselinck
Mutations in Soybean Microsomal Omega-3 Fatty Acid Desaturase Genes Reduce Linolenic Acid Concentration in Soybean Seeds
Crop Sci.,
August 1, 2005;
45(5):
1830 - 1836.
[Abstract]
[Full Text]
[PDF]
|
 |
|