Crop Science Illumina
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chronis, D.
Right arrow Articles by Krishnan, H. B.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Chronis, D.
Right arrow Articles by Krishnan, H. B.
Agricola
Right arrow Articles by Chronis, D.
Right arrow Articles by Krishnan, H. B.
Related Collections
Right arrow Plant Nutrition
Right arrow Seed Physiology
Published in Crop Sci. 43:1819-1827 (2003).
© 2003 Crop Science Society of America
677 S. Segoe Rd., Madison, WI 53711 USA

GENOMICS, MOLECULAR GENETICS & BIOTECHNOLOGY

Sulfur Assimilation in Soybean

Molecular Cloning and Characterization of O-Acetylserine (Thiol) Lyase (Cysteine Synthase)

Demosthenis Chronisa and Hari B. Krishnan*,b

a Dep. of Agronomy, Univ. of Missouri, Columbia, MO 65211
b USDA-ARS, Plant Genetics Research Unit, Univ. of Missouri, Columbia, MO 65211

* Corresponding author (KrishnanH{at}missouri.edu).


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Soybean [Glycine max (L.) Merr.] is a good protein source for both humans and livestock. However, soybean seed proteins are deficient in the sulfur-containing amino acids cysteine and methionine. This deficiency has stimulated efforts to improve the amino acid composition of soybean seed proteins. Our overall goal is to improve the sulfur amino acid content of soybean seed proteins by genetic manipulation. The objective of this study was to isolate and characterize O-acetylserine (thiol) lyase (OAS-TL), a key enzyme that catalyzes the last step in the production of cysteine. A full-length cDNA clone encoding a cytosolic isoform of OAS-TL was isolated by screening a soybean seed cDNA library with a 32P-labeled expressed sequence tag (EST). Nucleotide sequence analysis of the cDNA revealed a single open-reading frame of 978 base pairs (bp) encoding a 34-kDa protein. The authenticity of the isolated cDNA was confirmed by the functional complementation of an Escherichia coli cysteine auxotrophic mutant. Reverse transcriptase polymerase chain reaction (RT-PCR) analysis revealed that OAS-TL mRNA was abundant at early stages of seed development. Western blot analysis using antibodies generated against the recombinant soybean OAS-TL demonstrated that the abundance of this protein gradually declined during later stages of seed development. The OAS-TL activity peaked in young developing seeds and declined steadily during the time period when the bulk of seed storage protein accumulation occurred. Thus, elevating the specific activity of OAS-TL during later stages of seed development could lead to an increase in cysteine synthesis in soybean seeds.

Abbreviations: OAS-TL, O-acetylserine (thiol) lyase • ORF, open reading frame • PCR, polymerase chain reaction • RT-PCR, reverse transcriptase polymerase chain reaction • SAT, serine acetyltransferase


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
SOYBEAN TYPICALLY CONTAINS about 40% protein and 20% oil. Because of their high protein content, they are widely used as a protein source both for humans and animals. In the USA, soybeans are mainly used as animal feed. Soybean proteins are deficient in sulfur-containing amino acids (methionine and cysteine). Unlike plants, animals have a dietary requirement for sulfur amino acids. As a consequence, animal diets are often supplemented with synthetic sulfur amino acids to achieve optimal growth. The use of supplemental amino acids costs the poultry and swine industry approximately 100 million dollars annually. Therefore, improving the sulfur-amino acid content of soybean proteins will greatly benefit the livestock industry and improve the overall profitability of soybean farmers.

Soybean seed proteins are classified into 7S and 11S proteins and these together represent about 70% of the total seed protein (Nielsen, 1996; Krishnan, 2000). The 11S proteins are named glycinin, while the 7S proteins are known as ß-conglycinin. The 11S glycinin contains more of the sulfur-containing amino acids than the 7S ß-conglycinin. The ß-conglycinin is made up of three subunits, namely {alpha}', {alpha}, and ß. The ß-subunit lacks methionine (Coates et al., 1985) and is considered to be of very poor nutritional quality. Elimination or reduction of the ß-subunit of ß-conglycinin, therefore, may lead to improvement of the nutritional quality of soybean seed proteins. In fact, soybean seed storage protein mutants have been obtained that have low levels of 7S globulins and such mutants have 15% more methionine than other cultivars (Kitamura and Kaizuma, 1981). Recently, Imsande (2001) reported the isolation of soybean mutant lines with a methionine over-producing phenotype. It was reported such mutants had approximately 20% greater methionine and cysteine concentration in their seeds. The nutritional quality of soybean seed storage proteins has also been enhanced by expressing heterologous proteins that are rich in methionine. Introduction of methionine-rich 2S albumin from Brazil nut (Bertholletia excelsa Humb. & Bonpl.) drastically improved the methionine content of soybean (Nordlee et al., 1996). However, the introduced Brazil nut protein was an allergen, and consequently, the transgenic soybeans were not commercialized. Interestingly, transgenic soybeans expressing Brazil nut 2S albumin showed lower accumulation of Kunitz trypsin inhibitor (KTI) and chymotrypsin inhibitor (CI). The protease inhibitors are rich in sulfur-containing amino acids and the heterologous expression of 2S Brazil nut albumin has presumably shunted the sulfur amino acids from the protease inhibitors (Streit et al., 2001). This study indicates that there is a limitation in the sulfur amino acid pool in developing soybean seeds.

We are interested in improving the protein quality of soybean seed storage proteins. One of the approaches that we have undertaken is genetic manipulation of enzymes that are involved in the sulfur biosynthetic pathway. In spite of the importance of sulfur amino acids in determining the protein quality of soybean, we know very little about sulfur metabolism in soybean. Our objective was to identify and characterize enzymes involved in cysteine biosynthetic pathway in soybeans. The cysteine biosynthetic pathway is responsible for the fixation of inorganic sulfur into L-cysteine (Leustek et al., 2000). Cysteine is the first reduced sulfur-containing compound and serves as the sulfur donor for methionine. The cysteine biosynthetic pathway involves several enzymatic steps (Leustek and Saito, 1999). O-acetylserine (thiol) lyase [OAS-TL; EC 4.2.99.8] catalyzes the formation of cysteine from O-acetylserine (OAS) and hydrogen sulfide with the release of acetic acid.


Cysteine is the principal starting material for the synthesis of sulfur-containing amino acids, coenzymes, and sulfolipids (Leustek et al., 2000). In spite of the importance of this enzyme in sulfur metabolism, no molecular characterization of this enzyme in soybean has been reported. Here, we report the molecular cloning and characterization of OAS-TL from soybean, an enzyme that catalyzes the final step of the cysteine biosynthetic pathway.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Plant Material
Soybean cv. Williams 82 was field-grown at the Bradford Research and Extension Center near Columbia, MO, on a Mexico silt loam soil (Udollic Ochraqualf). Samples were collected from nodes 10 and 11 over time starting from the R5 stage (Fehr and Caviness, 1979). Seeds from four replications were collected for each time point. The pod walls were split open and seeds were frozen immediately in liquid nitrogen and stored at –80°C until use.

cDNA Isolation and Sequence Analysis
Total RNA from developing soybean seeds was isolated by the LiCl precipitation procedure (Lizzardi, 1983). Poly (A)+ RNA was isolated by oligo (dT)-cellulose chromatography. A cDNA library of soybean seed poly (A)+ RNA was constructed in lambda ZAP II following the manufacturer's protocol (Stratagene, La Jolla, CA). To isolate the OAS-TL cDNA clone, we synthesized primers (Forward: 5' GGGTTACAAGCTCATAATTAC 3'; Reverse: 5' GCACCTGTCATTGTACCACGAG 3') on the basis of published sequence of a EST clone (GenBank accession no. AW509442). These primers were utilized to amplify a 300-bp fragment from soybean genomic DNA. The polymerase chain reaction (PCR) fragment was purified from agarose gel and radiolabeled with [{alpha}-32P]dCTP (PerkinElmer Life Sciences Inc., Boston, MA) with a random labeling kit (Takara Bio Inc., Shiga, Japan). The soybean seed cDNA library was screened with the radiolabeled probe according to standard protocol (Sambrook et al., 1989). Three positive lambda clones were identified by colony hybridization and the plasmids from these clones were recovered with the use of the Rapid Excision Kit (Stratagene, La Jolla, CA). One of the positive clones (pSCS1) was chosen for further analysis. The cDNA insert was sequenced with a Taq Dye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA) at the DNA core facility of the University of Missouri using appropriate primers synthesized by Integrated DNA Technologies (Coralville, IA). The nucleotide sequence and the derived amino acid sequence of soybean seed OAS-TL were subjected to BLAST analysis (BLASTX, National Center for Biotechnology Information-NCBI). Restriction enzyme analysis was performed by means of NEBCutter 1.0 (New England Biolabs, Beverly, MA). Multiple sequence alignments were performed by CLUSTLAW software (European Bioinformatics Insitute, Germany; http://www.ebi.ac.uk/clustalw; verified 7 March 2003) and BOXSHADE (Pasteur Institute, France; http://bioweb.pasteur.fr/seqanal/interfaces/boxshade.html; verified 7 March 2003). A phylogenic tree was constructed with the help of the University of California database (University of California, San Diego, CA; http://workbench.sdsc.edu; verified 7 March 2003).

Isolation of Soybean Genomic DNA and Southern Blotting
Genomic DNA from soybean leaf (cv. Williams 82) was isolated by the standard hexadecyltrimethylammonium bromide (CTAB) method. Ten micrograms of genomic DNA were digested with BamHI, EcoRI, and HindIII overnight at 37°C. The digested samples were fractionated on a 0.8% (w/v) agarose gel. After electrophoresis, the DNA was partially hydrolyzed (15 min depurination in 0.25 M HCl; 30 min denaturation in 0.4 mol L-1 NaOH) before transfer to Hybond N+ membrane (Amersham Biosciences, Piscataway, NJ). After transfer, the filter was prehybridized overnight in hybridization buffer at 65°C (100 g kg-1 BSA, 500 mmol L-1 Na2HPO4, 10 mmol L-1 EDTA, 70 g kg-1 SDS, 100 mg L-1 salmon sperm DNA, total volume of 20 mL). Hybridization was performed at 65°C for 24 h with [{alpha}-32P]dCTP labeled OAS-TL probe. Following hybridization, the membrane was washed two times with 2x SSC (1x SSC is 0015 M NaCl plus 0.015 M sodium citrate), 10 g kg-1 SDS, once with 1x SSC, 10 g kg-1 SDS and finally two more times with 0.1x SSC, 10 g kg-1 SDS. Each wash was performed for 10 min at 65°C. Hybridizing bands were detected by autoradiography, using a DuPont (Wilmington, DE) Cronex Lightening Plus intensifying screen for signal enhancement.

Reverse Transcriptase Polymerase Chain Reaction (RT-PCR) Analysis
Total RNA from developing soybean seeds was extracted by means of Trizol Reagent according to the manufacturer's protocol (Invitrogen, Carlsbad, CA). Total RNA (0.1 µg) was used for the reverse transcriptase (RT) reaction. Before RT-PCR, the RNA was treated with DNase I (Invitrogen, Carlsbad, CA) to remove any contaminating DNA. The RT reaction was performed in a volume of 50 µL with the OneStep RT-PCR kit (Qiagen, Valencia, CA). Primers were designed from the 5' end and 3' end of the open-reading frame (ORF) of OAS-TL. The forward and reverse primers were 5'-CCAACATATGATGGCTGTTGAAAGGTCCGG-3' and 5'-GGTTGCGGCCGCTCAGGGCTCAAAAGTCATGC-3', respectively. The thermal cycler program was 50°C for 30 min, 95°C for 15 min, 30 cycles at 94°C (1 min), 58°C (1 min), and 72°C (1 min), followed by a final 10 min at 72°C. A 700-bp fragment of soybean 18S rRNA was also reverse-transcribed under similar conditions and used as a loading control. Primer sequences were as follows: Forward: 5'-GCTTAACACATGCAAGTCGAACGTTG-3', Reverse: 5'-ACCCCTACACACGAAATTCCACTC-3'. The PCR products were separated on a 7 g kg-1 agarose gel and photographed with an Eagle Eye II still video system (Stratagene, La Jolla, CA).

Western Blot Analysis
Seed proteins isolated from soybeans at different developmental stages were separated by SDS-PAGE (Laemmli, 1970) with a Mighty Small II electrophoresis system (Hoefer Scientific Instruments, San Francisco, CA). The proteins were resolved on a slab gel (10 x 8 x 0.75 cm) consisting of a 135 g kg-1 separation gel and a 40 g kg-1 stacking gel. Electrophoresis was performed at 20 mA constant current per gel at room temperature. After the completion of the electrophoresis, the gels were equilibrated with electrode buffer (25 nmol L-1 Tris, 192 mmol L-1 glycine, and 200 g kg-1 methanol, pH 8.3) for 15 min. Proteins from the gels were electroblotted onto pure nitrocellulose membrane (Midwest-Scientific, Valley Park, MO) essentially as described by Burnett (1981). The membranes were washed with TBS (80 mmol L-1 Tris-HCl, 200 mmol L-1 NaCl, pH 7.5) for 5 min and incubated with TBS containing 50 g kg-1 nonfat dried milk for 1 h at room temperature. Following this, the membrane was incubated overnight with polyclonal antibodies raised against soybean recombinant OAS-TL (Chronis and Krishnan, unpublished) that was diluted 1:5,000 in TBS containing 50 g kg-1 nonfat dried milk. Following three washes in TBS containing 0.8 g L-1 of Tween 20 (TBST) for 10 min each, the blot was incubated with HRP-conjugated goat anti-rabbit IgE (1:5,000 [v/v] dilution) in TBST containing 50 g kg-1 nonfat dried milk for 1 h with gentle agitation at room temperature. Final washes were performed with TBST (3 x 10 min) and TBS (1 x 5 min). Immunoreactive polypeptides were visualized by horseradish peroxidase color development procedure recommended by the manufacturer (Bio-Rad Laboratories, Richmond, CA).

Complementation of NK3 Cys- E. coli Auxotroph
We amplified the coding region of soybean OAS-TL with gene-specific primers (Forward 5'-CCAACATATGATGGCTGTTGAAAGGTCCGG-3' and Reverse 5'-GGTTGCGGCCGCTCAGGGCTCAAAAGTCATGC-3') to which NotI and NdeI restriction sites were introduced at the 5'and 3' ends, respectively. The PCR product was cloned into the NdeI and NotI sites of the expression vector pET 28(a)+ (Calbiochem-Novabiochem, San Diego, CA) resulting in pSCS10. The NK3 Cys- E. coli mutant [{Delta}trpE5 leu-6 thi hsdR hsdM+ cysK cysM], (obtained from Dr. Kazuki Saito, Chiba University, Chiba, Japan) was transformed with pSCS10 and the cloning vector pET-28a served as a negative control. For the genetic complementation of the cysteine requirement, the transformed E. coli cells were plated on M9 agar plates (Sambrook et al., 1989) supplemented with 100 mg L-1 kanamycin, 1 mmol L-1 IPTG and 0.2 g kg-1 leucine and tryptophan (Saito et al., 1992).

Determination of OAS-TL Activity
The OAS-TL activity was determined according to the protocol of Warrilow and Hawkesford (1998). Soybean seed samples (200 mg) were ground in a chilled mortar and pestle with 2 mL of ice-cold extraction buffer [100 mmol L-1 Tris-HCl pH 8.0, 100 mmol L-1 KCl, 20 mmol L-1 MgCl2, 10 g kg-1 Tween 80 and 10 mmol L-1 dithiothreitol (DTT)]. The samples were transferred to microcentrifuge tubes and centrifuged at 4°C for 10 min at 12 000 g. The clear supernatant was saved and used immediately for measuring the OAS-TL activity. Protein concentrations from seed extracts were determined spectrophotometrically with the help of DC Standard Protein Assay Kit (Bio-Rad Laboratories, Richmond, CA). The enzyme reaction mixture contained 5 mmol L-1 OAS, 3 mmol L-1 sodium sulphide, 10 mmol L-1 DTT and 0.1 mol L-1 sodium phosphate pH 8 in total volume of 0.2 mL. The reaction was initiated by the addition of OAS and the mixture was incubated at 26°C for 10 min. After the incubation period, 0.15 mL aliquots were removed and mixed with 0.35 mL of acidic ninhydrin reagent (13 g kg-1 ninhydrin in 1:4 HCl: HOAc) and heated at 100°C for 10 min to allow color development. After cooling on ice, 0.7 mL of ethanol were added and absorbance measured at 550 nm. One unit of enzyme activity is defined as the conversion of 1 nmol of OAS into cysteine per minute under the stated assay conditions. Assays were performed three times and each time was represented by two replications.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Isolation of a cDNA Encoding OAS-TL from a Soybean Seed cDNA Library
To isolate the OAS-TL cDNA clone from soybean seed cDNA library, we synthesized primers corresponding to 5' and 3' of an EST clone (AW509442) encoding OAS-TL. These primers were utilized to amplify a 300-bp fragment from soybean genomic DNA. This PCR product was labeled with 32P and used as a hybridization probe to screen a soybean seed cDNA library constructed in lambda ZAP II vector resulting in the isolation of three putative clones. Subsequent restriction enzyme digestion of the DNA isolated from the three positive cDNA clones showed the same restriction pattern for all of them, and one of these clones (PCS1) was chosen for further studies. The physical map of this cDNA clone is shown in Fig. 1A. To characterize the putative OAS-TL cDNA clone, the nucleotide sequence was determined at the DNA core facility of the University of Missouri. The nucleotide sequence revealed that the cDNA was 1267 bp long (Fig. 1A). Analysis of the DNA sequence using the ORF finder program identified a 978-bp-long ORF. The predicated ORF encodes a protein of 326 amino acids with a molecular mass of 34.2 kDa (Fig. 1B). The theoretical isoelectric point of the protein was estimated to be 5.83. O-acetylserine (thiol) lyase is a pyridoxal phosphate-dependent enzyme, and a lysine residue at the N-terminal region of this protein is involved in binding this cofactor (Saito et al., 1993). This lysine residue and the sequence around it are also conserved in soybean OAS-TL (Fig. 1B). The BLASTX program and pairwise amino acid comparison of the soybean seed OAS-TL showed significant homology to OAS-TL from plants and bacteria. Soybean OAS-TL had 81% identity with Oryza sativa L., 80.5% identity with Arabidopsis thaliana (L.) Heynh and 53.3% identity with E. coli OAS-TL (Fig. 2). A phylogenetic tree revealed that the OAS-TL isoforms could be divided into three major groups (chloroplastic, mitochondrial, and cytosolic) on the basis of their cellular location. Soybean OAS-TL was closely related to the cytosolic isoforms of OAS-TL from several other plant species (Fig. 2B). This prediction is consistent with our observation that the soybean OAS-TL lacks an amino terminal chloroplastic or mitochondrial transit peptide.



View larger version (65K):
[in this window]
[in a new window]
 
Fig. 1. A partial restriction map of soybean cDNA encoding the OAS-TL. The long arrow indicates the location of the open-reading frame (ORF). (B). Nucleotide sequence and deduced amino acid sequence of OAS-TL cDNA from soybean seed. The sequenced region covers 1267 nucleotides. The ORF for OAS-TL begins at position 82 and ends at position 1059 encoding a 34.2-kDa protein. The lysine residue that binds to pyridoxal 5'-phosphate is circled. The nucleotide sequence of OAS-TL cDNA from soybean appears in the GenBank database as accession No. AF452451.

 


View larger version (90K):
[in this window]
[in a new window]
 
Fig. 2. (A). Multiple alignment of the deduced amino acid sequence of OAS-TL. The sequences from rice (Accession No. Q9XEA8), Arabidopsis (Accession No. NP_193224), and E. coli (Accession No. P11096] are aligned with that of the soybean sequences from this study (Accession No. AF452451). Positions of amino acid identity are shaded black and similar residues are shaded in gray. (B) Phylogenic tree of OAS-Tl. The phylogenic tree was constructed using the University of California database. Cytosolic isoforms: Glycine max (Accession No. AF452451), Arabidopsis thaliana (Accession No. NP_193224), Solanum tuberosum (Accession No. BAB20861), Brassica juncea (Accession No. O23733), Spinacea oleracea (Accession No. Q00834), Citrulus lanatus (Accession No. Q43317), Oryza sativa (Accession No. Q9XEA8), Zea mays (Accession No. P80608), Allium tuberosum (Accession No. BAA93051), and Triticum aestivum (Accession No. P38076). Chloroplastic isoforms: Capsicum annuum (Accession No. P31300), Spinacea oleracea (Accession No. D14722), Nicotiana tabacum (Accession No. AJ299249), Solanum tuberosum (Accession No. O81155), and Arabidopsis thaliana (Accession No. S48695). Mitochondrial isoform: Arabidopsis thaliana (Accession No. X81973). Bacterial OAS-TL: Escherichia coli (Accession No. P11096), Nostocaceae (Accession No. NC_003272), Thermosynechococcus elongates (Accession No. NC_004113), Synechocystis (Accession No. P73410), and Mesorhizobium loti (Accession No. NC_002678).

 
To determine the gene copy number of OAS-TL in soybean genome, we performed Southern blot analysis using genomic DNA that was digested with different restriction enzymes. The restricted DNA was transferred to a nylon membrane and probed with 32P-labeled OAS-TL cDNA. Under stringent hybridization conditions, we were able to detect more than one hybridizing band (Fig. 3) in the different restriction digestions. This observation suggests that the OAS-TL is probably encoded by a multigene family in soybean.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 3. Southern blot analysis of soybean genomic DNA. Ten micrograms of soybean genomic DNA was restricted with BamHI (lane 1), EcoRI (lane 2), and HindIII (lane 3) and resolved on a 0.8% (w/v) agarose gel. The gel was blotted to Hybond N+ membrane followed by hybridization with 32P-labeled soybean seed OAS-TL cDNA insert. The positions of the Lambda HindIII molecular weight markers are shown at the left side of the figure.

 
Functional Complementation of NK3 Cysteine E. coli Auxotroph by Soybean OAS-TL
To verify if the isolated cDNA clone codes for a functional OAS-TL, we expressed the soybean cDNA in E. coli NK3, a cysteine auxotroph. This mutant lacks the gene for OAS-TL and therefore cannot grow in medium without supplemental cysteine. We cloned the coding region of the soybean OAS-TL in a protein expression vector (pET28a) resulting in a plasmid pSCS10. Escherichia coli NK3, transformed with pSCS10, was able to grow on M9 minimal medium without cysteine (Fig. 4). The cysteine auxotroph and the mutant carrying the cloning vector, however, were unable to support the growth in the absence of cysteine (Fig. 4). These results confirm that the cDNA isolated from soybean seed cDNA library codes for a functional OAS-TL.



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 4. Functional complementation of Cys- E. coli NK3 by transformation with the expression vector carrying soybean OAS-TL cDNA clone. The E. coli cysteine-auxotroph was transformed with pSCS10 and was streaked on M9 minimal agar plates with 0.5 mM cysteine (right plate) or without cysteine (left plate). The empty vector pET28a was used as a negative control.

 
Temporal Expression of OAS-TL mRNA during Seed Development
For comparison of the OAS-TL gene transcription levels during seed development, we performed RT-PCR analysis using total RNA isolated from seeds at different developmental stages. Using primers designed to amplify the entire coding region of the OAS-TL, we were able to obtain 1.0-kb RT-PCR product (Fig. 5). The RT-PCR product, which was abundant during the early stages of seed development, declined perceptibly at the late stages of seed development (Fig. 5). To exclude the possibility that the decline in the OAS-TL mRNA at later stages of seed development was due to differences in the amount of total RNA used as template in RT-PCR reactions, we performed control reactions by amplifying a 700-bp 18S ribosomal RNA. As expected, the abundance of the 18S ribosomal RNA RT-PCR products remained constant throughout the seed development (Fig. 5). The results from the RT-PCR analysis indicate that mRNA encoding the OAS-TL is abundant during the early stages and declines during the later stages of seed development.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 5. Reverse transcriptase (RT)-PCR detection of OAS-TL mRNA in developing soybean seeds. Total RNA isolated from soybean seeds harvested at 7-d intervals from 5 d after R5 stage (lanes 1–6) was used as a template for RT-PCR. The 18S ribosomal mRNA was used as quantitative control. Sizes of the molecular weight markers are indicated on the right side of the figure.

 
Accumulation of OAS-TL Polypeptide during Seed Development
Proteins extracted from developing soybean seeds when resolved by SDS-PAGE revealed the presence of prominent storage proteins (Fig. 6A). The 72- and the 70-kDa proteins are the {alpha}' and {alpha} subunits of ß-conglycinin. The 52-kDa ß-subunit of ß-conglycinin, which accumulates at late stages of seed development, was present only at very low concentration. The 37- and the 21-kDa abundant proteins represent the acidic and basic subunits of glycinin (Fig. 6A). To monitor the accumulation of the OAS-TL during seed development, Western blot analysis was performed with polyclonal antibodies raised against the purified soybean OAS-TL (Chronis and Krishnan, unpublished). The OAS-TL antibodies recognized a single 34-kDa protein from the total seed protein extract (Fig. 6B). The OAS-TL was detected throughout the seed development, but was present at relatively higher concentration during the early stages of seed development (Fig. 6B). This protein accumulation followed a similar trend as the RNA accumulation pattern.



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 6. Accumulation of OAS-TL during soybean seed development. (A) Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis of protein profiles of developing soybean seeds. Total seed proteins isolated from six different developmental stages (lanes 1–6) were resolved on a 10% (w/v) SDS-polyacrylamide gel and stained with Coomassie brilliant blue. (B). Western blot analysis. Total protein from developing soybean seeds was resolved by SDS-PAGE, transferred to nitrocellulose, and probed with antibodies raised against the soybean OAS-TL. Note that the antibody specifically recognizes a 34-kDa protein from the soybean seed extracts. The numbers in kilodaltons shown at the sides of the figures represent Bio-Rad (Richmond, CA) protein molecular weight markers (phosphorylase b, 97 400; bovine serum albumin, 66 200; ovalbumin, 45 000; carbonic anhydrase, 31 000; soybean trypsin inhibitor, 21 500; lysozyme, 14 400).

 
OAS-TL Activity Declines during Seed Development
The activity of OAS-TL was measured at different stages of seed development (Fig. 7). The OAS-TL activity, which was measured spectrophotometrically, was readily detected in soybean seed extracts. The specific activity of the enzyme was highest during the earliest stage of seed development and declined eight fold during the last stage of seed development examined in this study (Fig. 7). The results from RT-PCR, Western blot analysis, and the enzyme activity assays all revealed similar temporal accumulation patterns.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 7. OAS-TL activity in soybean seeds. Seed samples from nodes 10 and 11 were collected at weekly intervals starting from R5 and cysteine synthase activity was measured using crude seed extracts. Formation of cysteine was determined with an OAS-ninhydrin assay. Bars represent the standard error of the mean.

 

    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Although the role of OAS-TL in cysteine biosynthesis has been extensively studied in several plants, to our knowledge this is the first report to identify a full-length cDNA clone of OAS-TL in soybean (GenBank accession no. AF452451). The amino acid sequence of the soybean OAS-TL cDNA shows significant homology to those of other plant species and bacteria. Soybean OAS-TL contains the conserved PXXSVKDR motif that is characteristic of cysteine synthase. The lysine residue in this conserved motif has been shown to bind the co-factor pyridoxal 5'-phosphate. The OAS-TL has been purified from several plant species including Arabidopsis thaliana. (Hesse and Altmann, 1995), spinach (Saito et al., 1992; Warrilow and Hawkesford, 1998), the green algae Chlamydomonas reinhardtii (Ravina et al., 1999), rice (Nakamura et al., 1999), Allium tuberosum Rottler ex Sprengel (Ikegami et al., 1993; Urano et al., 2000), Citrullus vulgaris Schrader (Ikegami et al., 1988a), and Brassica juncea (L.) Czernj. & Cosson(Ikegami et al., 1988b). The enzyme consists of two identical monomers and a tightly bound co-factor pyridoxal 5'-phosphate (Rolland et al., 1996). Two to four isoforms of the enzyme have been isolated in higher plants by chromatographic separations and cDNA isolations (Ikegami et al., 1993; Kuske et al., 1994; Saito et al., 1992, 1993, 1994a, b; Warrilow and Hawkesford, 1998; Nakamura et al., 1999; Jost et al., 2000). The different isoforms of OAS-TL have been located in cytosol, plastids, and mitochondria. In A. thaliana, four genomic clones (oasA1, oasA2, oasB, and oasC) that encode OAS-TL have been identified and characterized. The oasA1, oasB, and oasC encode isoforms found in cytosol, the plastids, and the mitochondria, respectively. Based on the amino acid sequence homology, soybean OAS-TL appears to be related to the cytosolic isoforms.

The OAS-TL plays an important role in linking sulfur and nitrogen assimilatory pathways and controlling the flux between these two pathways (Leustek and Saito, 1999; Leustek et al., 2000). Consequently, cysteine synthesis depends on the availability of sulfur, OAS, and the activity of OAS-TL. The accumulation of soybean seed storage proteins is regulated by sulfur and nitrogen availability. Under excess nitrogen supply, the accumulation of the ß-subunit of ß-conglycinin is enhanced, while that of glycinin is inhibited (Gayler and Sykes, 1985; Paek et al., 1997). Kim et al. (1999) have shown that the promoter of the ß-subunit of ß-conglycinin is up-regulated by sulfur deficiency and downregulated by nitrogen deficiency. Further, they have shown that OAS accumulates in soybean cotyledons that were cultured under sulfur deficiency. This study clearly establishes the pivotal role of OAS in regulating the accumulation of the soybean seed storage proteins. Since OAS-TL uses OAS as a substrate it should be interesting to examine if nitrogen and sulfur deficiency also influence its activity in soybean.

The activity of ATP sulfurylase, an enzyme that catalyzes the adenylation of sulfate, has been investigated in developing soybean seeds (Sexton and Shibles, 1999). It was reported that the ATP sulfurylase activity was highest in seeds harvested 15 d after the R5 stage (about 1600 nmol ATP g fresh wt-1 min-1) and reached low levels (about 250 nmol ATP g fresh wt-1 min-1) at the R7 stage. We have observed similar changes in the OAS-TL specific activity. The RT-PCR results indicated that OAS-TL mRNA was barely present in mature seeds and this led to the observed decline in OAS-TL activity during the later stages of seed development. It remains to be seen if a similar decline in ATP sulfurylase mRNA also occurs during seed maturation. The decline in the activity of two enzymes involved in the biosynthesis of cysteine may explain the low content of sulfur-rich amino acids in soybean seed proteins. Because the bulk of seed storage proteins are synthesized during the mid-stage of seed development, it would be desirable to have sufficient supply of cysteine during this period. However, the decline in the activity of OAS-TL and ATP sulfurylase during this period indicates that the supply of sulfur-amino acids may be limiting. The limitation on cysteine can be overcome by manipulating the expression levels of enzymes involved in cysteine biosynthetic pathway.

The cysteine biosynthetic pathway is tightly regulated at several levels (Leustek and Saito, 1999; Leustek et al., 20000; Noji and Saito, 2002). The end product of sulfur assimilation, cysteine, is an allosteric inhibitor of the cytosolic form of serine acetyltransferase (SAT; EC 2.3.1.30). Serine acetyltransferase catalyses the formation of OAS from acetyl-CoA and serine. The OAS-TL activity is also regulated by its interaction with SAT (Bogdanova and Hell, 1997; Droux et al., 1998). OAS-TL and SAT form an enzyme complex through specific protein-protein interactions. In the bound form, SAT shows positive cooperativity, meaning higher affinity for its substrates. On the other hand, OAS-TL is completely inactivated in the bound form. OAS triggers the dissociation of the complex, and sulfide counteracts the action of OAS (Bogdanova and Hell, 1997; Droux et al., 1998). A lag in sulfide production will result in accumulation of OAS, which will slow its own synthesis by promoting the dissociation of the complex. Alternatively, the accumulation of sulfide will act as positive regulator in the association of SAT and OAS-TL thereby speeding the formation of OAS. Because the level of OAS influences the composition of soybean seed storage proteins (Kim et al., 1999), it will be important to clone and characterize soybean SAT, the enzyme responsible for the generation of OAS.


    ACKNOWLEDGMENTS
 
We thank Dr. Kazuki Saito (Chiba University, Chiba, Japan) for providing us with the NK3 E. coli mutant. The authors would like to thank Drs. Larry Darrah and Jerry White for critical reading of the manuscript.

Received for publication November 20, 2002.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 




This article has been cited by other articles:


Home page
J Exp BotHome page
L. Tabe, M. Wirtz, L. Molvig, M. Droux, and R. Hell
Overexpression of serine acetlytransferase produced large increases in O-acetylserine and free cysteine in developing seeds of a grain legume
J. Exp. Bot., March 1, 2010; 61(3): 721 - 733.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Kumaran, H. Yi, H. B. Krishnan, and J. M. Jez
Assembly of the Cysteine Synthase Complex and the Regulatory Role of Protein-Protein Interactions
J. Biol. Chem., April 10, 2009; 284(15): 10268 - 10275.
[Abstract] [Full Text] [PDF]


Home page
Crop Sci.Home page
H. B. Krishnan
Engineering Soybean for Enhanced Sulfur Amino Acid Content
Crop Sci., January 31, 2005; 45(2): 454 - 461.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (8)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chronis, D.
Right arrow Articles by Krishnan, H. B.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Chronis, D.
Right arrow Articles by Krishnan, H. B.
Agricola
Right arrow Articles by Chronis, D.
Right arrow Articles by Krishnan, H. B.
Related Collections
Right arrow Plant Nutrition
Right arrow Seed Physiology


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
The SCI Journals Agronomy Journal Vadose Zone Journal
Journal of Natural Resources
and Life Sciences Education
Soil Science Society of America Journal
Journal of Plant Registrations Journal of
Environmental Quality
The Plant Genome