Crop Science 43:760-766 (2003)
© 2003 Crop Science Society of America
CROP BREEDING, GENETICS & CYTOLOGY
Marker Assisted Evaluation of Fusarium Head Blight Resistant Wheat Germplasm
Sixin Liu and
J. A. Anderson*
Department of Agronomy and Plant Genetics, University of Minnesota, St. Paul, MN 55108
* Corresponding author (ander319{at}umn.edu)
 |
ABSTRACT
|
|---|
A major QTL (quantitative trait locus) for Fusarium head blight (FHB) resistance, Qfhs.ndsu-3BS, derived from Sumai 3, has been identified and verified by several research groups via molecular marker analysis. Further study of this QTL is worthwhile because it explains a large portion (2560%) of the variation in FHB resistance in the reported studies. The objectives of this study were to (i) identify additional molecular markers for Qfhs.ndsu-3BS, (ii) construct a cytologically based physical map of chromosome 3BS, and (iii) identify germplasm with novel FHB resistance genes with SSR markers near Qfhs.ndsu-3BS. Two new simple sequence repeat (SSR) markers (XBARC133 and XBARC102), two sequence tagged site (STS) markers (XSTS3B1 and Xsun2), and one restriction fragment length polymorphism (RFLP) marker (Xfbb185), were mapped to the Qfhs.ndsu-3BS region. On the basis of deletion line analysis, this major QTL is likely located on the deletion bin 3BS 0.78-0.87. Fifty-four FHB resistant lines from throughout the world and 20 North American spring wheat (Triticum aestivum L.) lines of historical prominence were genotyped by five SSR markers (Xgwm389, Xgwm533, XBARC133, Xgwm493, and XBARC102) associated with Qfhs.ndsu-3BS. The Sumai 3 haplotype is rare. Only 25 out of 54 FHB resistant lines and one North American spring wheat line have Sumai 3-type alleles for at least one of these five SSR markers. Twelve FHB resistant lines have the same SSR allele as Sumai 3 for at least four of the five SSR markers, and therefore most likely contain this major QTL. The other 42 FHB resistant lines may carry novel FHB resistance genes, and are worthy of further genetic study.
Abbreviations: AFLP, amplified length polymorphism EST, expressed sequence tag FHB, Fusarium head blight PIC, polymorphism information content QTL, quantitative trait loci RFLP, restriction fragment length polymorphism SSR, simple sequence repeat STS, sequence tagged site
 |
INTRODUCTION
|
|---|
FUSARIUM HEAD BLIGHT, also known as scab, caused mainly by Fusarium graminearum Schwabe [telomorph: Gibberella zeae Schw.(Petch)], is a devastating disease of wheat in regions that are warm and humid during flowering. In addition to significant yield and quality losses, the mycotoxin deoxynivalenol produced by the pathogen in infected wheat kernels is a serious problem for food and feed safety. Host resistance has long been considered the most practical and effective means of controlling FHB. However, wheat breeding for FHB resistance is hindered by laborious screening systems, quantitative inheritance, and poor genetic characterization of resistance sources.
Application of molecular markers has provided a new tool to study the genetics of FHB resistance. Most genetic studies have concentrated on Type II resistance (resistance to spread of infection within the spike; Schroeder and Christensen, 1963) of the Chinese cultivar Sumai 3 and its derivatives, which are widely used as FHB resistance sources. Five FHB resistance QTLs were identified in a Sumai 3/Stoa population (Waldron et al., 1999). The major QTL derived from Sumai 3 was designated as Qfhs.ndsu-3BS, and verified in a second mapping population [ND2603(Sumai 3/Wheaton)/Butte 86] (Anderson et al., 2001). The best SSR markers explained 41.6 and 24.8% of the variation in FHB resistance in the two mapping populations (Anderson et al., 2001). Bai et al. (1999) reported AFLP (amplified length polymorphism) markers for a major QTL that explained up to 60% of the variation for FHB resistance. This QTL was derived from Ning7840, which is believed to have inherited its FHB resistance from Sumai 3 (Liu and Wang, 1990). After integration of SSR markers into the original AFLP maps, this QTL was assigned to a similar position as Qfhs.ndsu-3BS (Zhou et al., 2000). Furthermore, Qfhs.ndsu-3BS was also identified in a double-haploid mapping population of a cross CM-82036(Sumai 3/Thornbird-S)/Remus and explained up to 60% of the phenotypic variance for Type II FHB resistance (Buerstmayr et al., 2002).
Although Sumai 3 and its derivatives have been successfully used as FHB resistance sources worldwide, additional resistance genes are needed to avoid complete dependence on only a few genes from one source. Moreover, the FHB resistance level is not high enough to prevent economic damage under high disease pressure. Therefore, identification of new FHB resistance sources is vital for continued improvement of FHB resistance in wheat. Wheat accessions with good FHB resistance have been reported after a systematic evaluation of wheat germplasm for FHB reaction (Zhang et al., 2000, 2001; Gilchrist et al., 2001). However, the genetic relationships among FHB resistant germplasm have not been well characterized. Pedigree information can provide a direct and preliminary estimate of the genetic relationships of FHB resistant germplasm. However, pedigrees for some FHB resistant lines are not available and errors in the recording of pedigrees are another problem encountered in pedigree analysis.
Evaluation of disease reactions with different isolates or races of a pathogen can differentiate race-specific disease resistance genes. However, this is not possible when screening FHB resistant germplasm due to a lack of evidence for strain-specific resistance (Wang and Miller, 1988; van Eeuwijk et al., 1995). Allelism tests are another means of differentiating among disease resistance genes, but these require extensive crossing and progeny tests. This is both time consuming and often imprecise with quantitatively inherited traits such as FHB resistance. Fortunately, the SSR markers that flank Qfhs.ndsu-3BS allow us to use the considerable polymorphism information content (PIC) inherent in this marker type (Röder et al., 1995) to determine if FHB resistant lines are likely to contain this major QTL. The objectives of this study were to (i) identify additional molecular markers associated with Qfhs.ndsu-3BS, (ii) construct a cytologically based physical map of chromosome 3BS, and (iii) identify germplasm with novel FHB resistance genes with SSR markers near Qfhs.ndsu-3BS.
 |
MATERIALS AND METHODS
|
|---|
Genetic Mapping
Fusarium head blight screening of the two mapping populations derived from crosses Sumai 3/Stoa and ND2603/Butte 86 was described by Waldron et al. (1999) and Anderson et al. (2001), respectively. One hundred eighty-two microsatellites, designated with the prefix "BARC", were kindly provided by Q.J. Song and P. Cregan, USDA-ARS, Beltsville, MD. Nullisomic-tetrasomic line N3BT3A (Sears, 1966) and ditelosomic line 3BL (Sears and Sears, 1979) were used to identify microsatellite markers located on chromosome 3BS. Primers (forward primer: 5' AGACGTTGGACAATGGGTTC 3'; reverse primer: 5' TATCTATGCGGGCTTTCGAC 3') of an STS marker, XSTS3B1, were designed from the sequence information of the wheat EST (expressed sequence tag), BE444576. This EST was mapped to the deletion bin 3BS8-0.78-1.00 by participants in the NSF-supported U.S. wheat EST project (http://wheat.pw.usda.gov/NSF/; verified 20 December 2002). Another STS marker, Xsun2 (Sharp et al., 2001), derived from the RFLP marker Xglk683 located on chromosome 3BS, was kindly provided by P.J. Sharp, University of Sydney, Australia. PCR reactions were performed in a total volume of 10 µL containing 100 nM of each primer, 0.2 mM of each deoxynucleotide, 1.5 mM MgCl2, 0.5 unit Taq polymerase and 30 to 45 ng template DNA. After an initial denaturing step for 3 min at 94°C, 35 cycles were performed with 1 min at 94°C, 1 min at 50, 55, or 60°C (depending on the individual primers), 2 min at 72°C, followed by a final extension step of 10 min at 72°C. Products of PCR were run on polyacrylamide gels containing 32% (v/v) formamide as described by Litt et al. (1993) and were visualized by silver staining according to the protocol of Bassam et al. (1991). One RFLP marker, Xfbb185, provided by P. Leroy, INRA, Clermont-Ferrand, France, was also mapped as described by Riede and Anderson (1996). The linkage map was constructed by means of MAPMAKER Macintosh v2.0 (Lander et al., 1987) and the computer program QGENE (Nelson, 1997) was used for interval mapping.
Cytologically Based Physical Mapping
Seven chromosome 3BS deletion lines (Endo and Gill, 1996), kindly provided by B.S. Gill, Kansas State University, Manhattan, KS, were used to generate a cytologically based chromosome 3BS physical map. The SSR and STS markers located on chromosome 3BS were mapped to chromosome regions flanked by breakpoints of the smallest deletion lacking the marker and the largest deletion possessing the marker.
Genetic Diversity near Qfhs.ndsu-3BS
Fifty-four FHB resistant lines from throughout the world were used in this study, including 24 resistant and three moderately resistant FHB resistant lines (Table 1) (Zhang et al., 2000), kindly provided by Y. Jin, South Dakota State University, Brookings, SD; 15 FHB resistant CIMMYT lines (Table 2) kindly provided by A. L. McKendry, University of Missouri, Columbia, MO; Sumai 3; and 11 other FHB resistant lines (Table 2) collected by the wheat breeding program at the University of Minnesota. Twenty North American spring wheat cultivars (Table 3) of historical prominence (van Beuningen and Busch, 1997) were also used in this study to obtain a better estimation of the PIC values and allele distribution of the SSR markers near Qfhs.ndsu-3BS. The 20 North American spring wheat cultivars have no known Chinese germplasm in their pedigrees. Coleoptiles were harvested from five seeds per line to extract DNA (Riede and Anderson, 1996). Allele types at five SSR marker loci (Xgwm389, Xgwm533, XBARC133, Xgwm493, and XBARC102) were determined for each of the 74 lines. The SSR markers XBARC75 and XBARC87 were excluded from the genetic diversity study because of their low PIC values (unpublished data). PIC values were estimated as described by Anderson et al. (1993) with the following formula.
View this table:
[in this window]
[in a new window]
|
Table 1. Haplotypes of 24 FHB resistant lines and three moderately resistant lines characterized with the five SSR markers for Qfhs.ndsu-3BS.
|
|

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 3. Haplotypes of 54 FHB resistant lines and 20 Northern American spring wheat cultivars based on allele type of five SSR markers near Qfhs.ndsu-3BS. Darkened boxes represent Sumai 3 alleles and open boxes represent non-Sumai 3 alleles. The numbers in parentheses represent the number of Northern American spring wheat cultivars with the specific haplotype.
|
|
View this table:
[in this window]
[in a new window]
|
Table 2. Haplotypes of 15 CIMMYT lines and 11 other FHB resistant lines characterized with the five SSR markers for Qfhs.ndsu-3BS.
|
|
View this table:
[in this window]
[in a new window]
|
Table 3. Haplotypes of 20 Northern American spring wheat cultivars characterized with the five SSR markers near Qfhs.ndsu-3BS.
|
|
Where Pij is the frequency of the jth pattern for marker i and summation extends over n patterns.
 |
RESULTS AND DISCUSSION
|
|---|
Genetic Mapping
Nine out of the 182 BARC microsatellite markers screened were located on chromosome 3BS via aneuploid analysis. The chromosomal assignments of the nine markers except XBARC139 have been confirmed by independent studies (Singh et al., 2001; http://www.scabusa.org/pdfs/BARC_SSRs_011101.html; verified 20 December 2002). Seven out of the nine BARC markers on chromosome 3B were mapped in at least one of the two mapping populations (Fig. 1), Sumai 3/Stoa and ND2603/Butte 86. One of the three loci amplified by XBARC101 also was mapped on chromosome 3BS (Fig. 1). XBARC101was not assigned to chromosome 3BS via aneuploid analysis because Chinese Spring, the genetic background of the aneuploid stocks, contains a null allele at this locus. Both STS markers, XSTS3B1 and Xsun2, were polymorphic between Sumai 3 and Stoa, and were mapped in this population. XSTS3B1 was also mapped in the ND2603/Butte 86 population. The results of interval mapping of chromosome 3BS (Fig. 1) are similar to those reported previously (Anderson et al., 2001), with the addition of five new DNA markers, XSTS3B1, Xsun2, XBARC133, XBARC102, and Xfbb185, in this region. The new DNA markers provide more options for marker-assisted selection for FHB resistance even though the variation in FHB resistance explained by the new markers (Table 4) is not higher than the best markers identified previously (Anderson et al., 2001).

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 1. Interval analysis of chromosome 3BS for FHB resistance in two mapping populations, Sumai 3/Stoa (left) and ND2603/Butte 86 (right). The thick line contour in each map is based on the mean of two greenhouse FHB evaluation experiments, and the thin line contours are based on the individual experiments (Anderson et al., 2001).
|
|
View this table:
[in this window]
[in a new window]
|
Table 4. Coefficients of determination and LOD values of DNA markers for Qfhs.ndsu-3B in the Sumai3/Stoa and ND2603/Butte 86 recombinant inbred populations.
|
|
Cytologically Based Physical Mapping
The cytologically based physical map of chromosome 3BS (Fig. 2) is consistent with published maps (Delaney et al., 1995; Zhou et al., 2000; http://www.scabusa.org/pdfs/BARC_SSRs_011101.html). On the basis of the physical positions of three markers Xgwm389, Xgwm533 and Xgwm493, it was not clear whether Qfhs.ndsu-3BS is located between the breakpoints between deletion lines 3BS-3 and 3BS-8 or distal to the breakpoint of 3BS-3 (Zhou et al., 2000). In this study, markers Xsun2, Xgwm533, XBARC133, Xgwm493, XBARC87, and XBARC102, which are associated with Qfhs.ndsu-3BS, were located on the chromosome fragment flanked by the breakpoints of deletion lines 3BS-3 and 3BS-8. Also, the three molecular markers (Xgwm389, XSTS3B1.1 and XBARC75) located in the deletion bin 3BS 0.87-1.00 (Fig. 2) are far from the peak of the LOD curve (Fig. 1). Therefore, Qfhs.ndsu-3BS is likely located on the deletion bin 3BS 0.78-0.87. We are using deletion lines 3BS-3 and 3BS-8 to target more molecular markers located on the deletion bin 3BS 0.78-0.87. Our fine mapping efforts also will benefit greatly from the ongoing U.S. wheat EST project. One of the objectives of this project is to map 10 000 nonredundant ESTs with wheat deletion lines. As of April of year 2002, 30 ESTs had been mapped to the chromosome 3BS deletion bin 3BS8-0.78-1.00 (http://wheat.pw.usda.gov/NSF/). We are using these 30 ESTs for fine mapping of Qfhs.ndsu-3BS. As shown in Fig. 1, the STS marker XSTS3B1, derived from one of the 30 ESTs, has been mapped in both populations.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 2. Cytologically based physical map of chromosome 3BS. The breakpoints of deletion lines are indicated by horizontal lines. The fraction length (FL) of the retained arm and the name of the deletion lines are listed on the left of the chromosome diagram. The markers mapped to the corresponding deletion bins are listed on the right. The patterned deletion bin is the most likely chromosome fragment containing Qfhs.ndsu-3BS.
|
|
Genetic Diversity near Qfhs.ndsu-3BS
The SSR markers Xgwm389, Xgwm533, XBARC133, Xgwm493, and XBARC102 are highly polymorphic. They had PIC values of 0.70 to 0.84, and detected 8 to 14 alleles among the 74 lines (Fig. 3). No amplification products were obtained from 5 and 10 lines with primers for the SSRs gwm389 and gwm533, respectively. All nulls were confirmed in repeated experiments and finally scored as null alleles. The five SSR markers are either dinucleotide or trinucleotide microsatellites (Röder et al., 1998). The size difference among some alleles is two or three nucleotides. Therefore, detection systems must be able to distinguish these small differences. A drawback of some dinucleotide microsatellites is that products amplified from each allele consist of not just one fragment, but a series of fragments (Fig. 4). This characteristic of dinucleotide microsatellites may make unambiguous genotyping difficult even with regular sequencing gels. We have found that sequencing gels containing 32% formamide as described in the materials and methods greatly improve the resolution of most microsatellites and lead to unambiguous genotyping.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 4. Thirteen alleles detected with the SSR marker Xgwm389. The Sumai 3 allele is indicated by an arrow. The first and the last lanes are the molecular size ladder.
|
|
Eight haplotypes were identified among the 74 lines (Fig. 3) when the marker alleles for the five SSR markers are scored as two allele types, Sumai 3 alleles and non-Sumai 3 alleles. The Sumai 3 haplotype (haplotype 1) is rare, which is important for us to trace Qfhs.ndsu-3BS with molecular markers. Only one North American spring wheat cultivar, Kota (Table 3), has a Sumai 3-type allele and that is for marker XBARC133 only (haplotype 6). None of the other 19 lines have Sumai 3-type alleles at any of the five SSR loci (haplotype 8). This result is consistent with our observation from marker-assisted selection activities. Out of 137 parental lines in our breeding program, only one line without Sumai 3 or its derivatives in its pedigree has Sumai 3-type alleles for all three markers (Xgwm389, Xgwm533, and Xgwm493) screened in the 3BS region (Pumphrey et al., unpublished). Among the 54 FHB resistant lines analyzed, only 25 have Sumai 3-type alleles for at least one SSR marker (haplotyes 17).
Six FHB resistant lines, Jinshan88-102, CM-82036, Ning894037, CIMMYT14, Wuhan 3, and Fujian 5114, have the same genotype as that of Sumai 3 for all the five SSR markers, and therefore most likely contain Qfhs.ndsu-3BS. This conclusion is consistent with the results of molecular mapping of FHB resistance in CM82036 (Buerstmayr et al., 2002), Ning894037 (Shen and Ohm, 2001), Wuhan 3 (McGowan et al., 2001), and Fujian 5114 (Bowen et al., 2001) in which a FHB resistance QTL located on chromosome 3BS was reported. Five FHB resistant lines, Sumey-3 (haplotype 4), CIMMYT19 (haplotype 3), CIMMYT24 (haplotype 2), PI350768 (haplotype 2), and PI349478 (haplotype 2), have the Sumai 3-type alleles for four out of the five SSR markers. Those lines likely also have the same QTL as Sumai 3 in the 3BS region. Landrace cultivars PI350768 from Austria and PI349478 from Switzerland have identical alleles for all of the five SSR markers, and they have Sumai 3-type alleles except for marker Xgwm389. It would be interesting to validate if they carry Qfhs.ndsu-3BS because our unpublished results indicate that the Italian cultivar Funo, one of the parents of Sumai 3, is not the donor of Qfhs.ndsu-3BS, on the basis of its SSR haplotype. Therefore, we believe that this QTL originates from the Chinese landrace cultivar Taiwan wheat, the other parent of Sumai 3, a finding substantiated by Bai et al. (2001).
Thirteen FHB resistant lines have the Sumai 3-type alleles for both or either marker Xgwm389 and marker XBARC133 (haplotypes 5-7). It is possible that those haplotypes may be produced by allele recombination involving a Sumai 3 source. However, there is no known Chinese germplasm in their pedigrees for most of the 13 lines. It is most likely that the Sumai 3-type alleles of those lines are derived from other independent origins instead of Sumai 3. Thus, these lines are unlikely to carry Qfhs.ndsu-3BS. To limit the false results because of independent origins of Sumai 3-type alleles and genetic recombination between Qfhs.ndsu-3BS and molecular markers, it is advisable to use at least the three interior markers shown in Fig. 4 to characterize lines for the presence of this QTL. Twenty-nine FHB resistant lines (haplotype 8) are distinct from Sumai 3 for all the five SSR markers. Those lines may carry novel FHB resistance QTLs, and further study is worthwhile. At least one of the lines, Frontana, is known to have different FHB resistance QTL from Sumai 3 (van Ginkel et al., 1996).
Novel FHB resistance genes are needed to provide wheat breeding programs with genetic resources to combat this disease. As many as 42 lines that may carry novel FHB resistance genes have been identified in this study. Although other research groups have tested these lines for FHB reaction, not all of them have been extensively tested in our program. It would be prudent to confirm that these lines have high level of FHB resistance before conducting any further genetic studies and introgression into adapted germplasm.
Molecular mapping is an important tool to study the genetics of FHB resistance. To avoid redundant mapping studies that are time-consuming and expensive, it is more reasonable to study germplasm that may not contain Qfhs.ndsu-3BS. In other words, lines that carry a high level of FHB resistance and are different from Sumai 3 at the five SSR loci are more suitable for new molecular mapping studies. Among the 24 FHB resistant lines provided by Y. Jin, South Dakota State University (Table 1), Tokai 66 and Nyu Bai have stable low FHB index and low Fusarium damaged kernels over several FHB evaluation experiments (Zhang et al., 2000, 2001). They are also distinct from Sumai 3 for four out of the five SSR markers and therefore are good candidates for further genetic studies.
 |
ACKNOWLEDGMENTS
|
|---|
We are grateful to Drs. Q.J. Song and P. Cregan for providing the BARC microsatellites for this study. We would like to thank Dr. B.S. Gill for providing the deletion lines and Dr. P.J. Sharp for providing a STS marker on 3BS. The authors would like to express sincere appreciation to Dr. Y. Jin, X. Zhang, and Dr. A. McKendry for providing germplasm, and for the assistance of members in the wheat breeding project, University of Minnesota. Funding was provided by the Minnesota Agricultural Experiment Station and the U.S. Wheat and Barley Scab Initiative.
Received for publication April 30, 2002.
 |
REFERENCES
|
|---|
- Anderson, J.A., G.A. Churchill, J.E. Autrique, S.D. Tanksley, and M.E. Sorrells. 1993. Optimizing parental selection for genetic linkage maps. Genome 36:181186.[Web of Science][Medline]
- Anderson, J.A., R.W. Stack, S. Liu, B.L. Waldron, A.D. Fjeld, C. Coyne, B. Moreno-Sevilla, J. Mitchell Fetch, Q.J. Song, P.B. Cregan, and R.C. Frohberg. 2001. DNA markers for Fusarium head blight resistance QTLs in two wheat populations. Theor. Appl. Genet. 102:11641168.[Web of Science]
- Bai, G., F.L. Kolb, G. Shaner, and L.L. Domier. 1999. Amplified fragment length polymorphism markers linked to a major quantitative trait locus controlling scab resistance in wheat. Phytopathology 89:343348.[Medline]
- Bai, G., P. Guo, and F.L. Kolb. 2001. Genetic diversity in scab-resistant wheat cultivars based on molecular markers. p. 7. In S. Canty et al. (ed.) Proceedings of the 2001 National Fusarium Head Blight Forum. Kinko's, Okemos, MI.
- Bassam, B.J., G. Caetano-Anolles, and P.M. Gresshoff. 1991. Fast and sensitive silver staining of DNA in polyacrylamide gels. Anal. Biochem. 196:8083.[Web of Science][Medline]
- Bowen, D.E., S. Liu, R. Dill-Macky, C.K. Evans, and J.A. Anderson. 2001. Mapping of Fusarium head blight QTL in the Chinese line Fujian 5114. p. 175. In S. Canty et al. (ed.) Proceedings of the 2001 National Fusarium Head Blight Forum. Kinko's, Okemos, MI.
- Buerstmayr, H., M. Lemmens, L. Hartl, L. Doldi, B. Steiner, M. Stierschneider, and P. Ruckenbauer. 2002. Molecular mapping of QTLs for Fusarium head blight resistance in spring wheat. I. Resistance to fungal spread (Type II resistance). Theor. Appl. Genet. 104:8491.[Web of Science][Medline]
- Delaney, D.E., S. Nasuda, T.R. Endo, and B.S. Gill. 1995. Cytologically based physical maps of the groups chromosomes of wheat. Theor. Appl. Genet. 91:780782.[Web of Science]
- Endo, T.R., and B.S. Gill. 1996. The deletion stocks of common wheat. J. Hered. 87:295307.[Abstract/Free Full Text]
- Gilchrist, L., M. van Ginkel, S. Rajaram, H. Vivar, and F. Capettini. 2001. Germplasm contribution of the CIMMYT wheat program to the U.S. wheat and barley scab initiative. p. 176179. In S. Canty et al. (ed.) Proceedings of the 2001 National Fusarium Head Blight Forum. Kinko's, Okemos, MI.
- Lander, E.S., P. Green, J. Abrahamson, A. Barlow, M.J. Daly, S.E. Lincoln, and L. Newburg. 1987. MAPMAKER: an interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1:174181.[Medline]
- Litt, M., X. Hauge, and V. Sharma. 1993. Shadow bands seen when typing polymorphic dinucleotide repeats: some causes and cures. Biotechniques 15:280283.[Web of Science][Medline]
- Liu, Z.Z., and Z.Y. Wang. 1990. Improved scab resistance in China: sources of resistance and problems. p. 178188. In D.A. Saunders (ed.) Proceeding of an International Conference on Wheat for the nontraditional warm areas, CIMMYT, Mexico.
- McGowan, K.L., S. Liu, R. Dill-Macky, C.K. Evans, and J.A. Anderson. 2001. Mapping of Fusarium head blight QTL in wheat line Wuhan 3. p. 193. In S. Canty et al. (ed.) Proceedings of the 2001 National Fusarium Head Blight Forum. Kinko's, Okemos, MI.
- Nelson, J.C. 1997. QGENE: software for marker-based genomic analysis and breeding. Mol. Breed. 3:239245.
- Riede, C.R., and J.A. Anderson. 1996. Linkage of RFLP markers to an aluminum tolerance gene in wheat. Crop Sci. 36:905909.[Abstract/Free Full Text]
- Röder, M.S., J. Plaschke, S.U. Köing, A. Börner, M.E. Sorrells, S.D. Tanksley, and M.W. Ganal. 1995. Abundance, variability and chromosomal location of microsatellites in wheat. Mol. Gen. Genet. 246:327333.[Web of Science][Medline]
- Röder, M.S., V. Korzun, K. Wendehake, J. Plaschke, M.H. Tixier, P. Leroy, and M.W. Ganal. 1998. A microsatellite map of wheat. Genetics 149:20072023.[Abstract/Free Full Text]
- Schroeder, H.W., and J.J. Christensen. 1963. Factors affecting the resistance of wheat to scab caused by Gibberella zeae. Phytopathology 53:831838.[Web of Science]
- Sears, E.R. 1966. Nullisomic-tetrasomic combinations in hexaploid wheat. p. 2947. In R. Riley and K.R. Lewis (ed.) Chromosome manipulation and plant genetics. Oliver and Boyd, Edinburgh.
- Sears, E.R., and L.M.S. Sears. 1979. The telocentric chromosomes of common wheat. P. 389407. In S. Ramanujan (ed.) Proc. 5th Int. Wheat Genet. Symp., Indian Society of Genetics and Plant Breeding. Indian Agric. Res. Inst., New Dehli.
- Sharp, P.J., S. Johnston, G. Brown, R.A. McIntosh, M. Pallotta, M. Carter, H.S. Bariana, S. Khatkar, E.S. Lagudah, R.P. Singh, M. Khairallah, R. Potter, and M.G.K. Jones. 2001. Validation of molecular markers for wheat breeding. Aust. J. Agric. Res. 52:13571366.
- Shen, X., and H. Ohm. 2001. QTLs of FHB resistance in wheat line Ning 894037. p. 272. In S. Canty et al. (ed.) Proceedings of the 2001 National Fusarium Head Blight Forum. Kinko's, Okemos, MI.
- Singh, S., Q. Song, and J. Shi. GL Brown-Guedira, B.S. Gill, P.B. Cregan, and R.W. Ward. 2001. Physical mapping of Microsatellite markers on wheat chromosome. P. 3536. In S. Canty et al. (ed.) Proceedings of the 2001 National Fusarium Head Blight Forum. Kinko's, Okemos, MI.
- van Beuningen, L.T., and R.H. Busch. 1997. Genetic diversity among North American spring wheat cultivars: I. Analysis of the coefficient of parentage matrix. Crop Sci. 37:570579.[Abstract/Free Full Text]
- van Eeuwijk, F.A., A. Mesterhazy, C.I. Kling, P. Ruckenbauer, L. Saur, H. Burstmayr, M. Lemmens, L.C.P. Keizer, N. Maurin, and C.H.A. Snijders. 1995. Assessing non-specificity of resistance in wheat to head blight caused by inoculations with European strains of Fusarium culmorum, F. graminearum and F. nivale using a multiplicative model of interaction. Theor. Appl. Genet. 90:221228.[Web of Science]
- van Ginkel, M., W. Van der Schaar, and Z. Yang. 1996. Inheritance of resistance to scab in two wheat cultivars from Brazil and China. Plant Dis. 80:863867.
- Waldron, B.L., B. Moreno-Sevilla, J.A. Anderson, R.W. Stack, and R.C. Frohberg. 1999. RFLP mapping of QTL for Fusarium head blight resistance in wheat. Crop Sci. 39:805811.[Abstract/Free Full Text]
- Wang, Y.Z., and J.D. Miller. 1988. Screening techniques and sources of resistance to Fusarium head blight. p. 239250. In A.R. Klatt (ed.) Wheat production constrains in tropical environments. CIMMYT, Mexico.
- Zhang, X., Y. Jin, J. Rudd, and H. Bockelman. 2001. Evaluation of USDA spring wheat germplasm for Fusarium head blight resistance. p. 220224. In S. Canty et al. (ed.) Proceedings of the 2001 National Fusarium Head Blight Forum. Kinko's, Okemos, MI.
- Zhang, X., Y. Jin, R. Rudd, T. Hall, J. Rudd, and H. Bockelman. 2000. Fusarium head blight resistance sources of spring wheat identified from the USDA collection. p. 228233. In R. Ward et al. (ed.) Proceedings of the 2000 National Fusarium Head Blight Forum. Kinko's, Okemos, MI.
- Zhou, W.C., F.L. Kolb, G. Bai, G. Shaner, and L.L. Domier. 2000. SSR mapping and sub-arm physical location of a major scab resistance QTL in wheat. p. 6972. In R. Ward et al. (ed.) Proceedings of the 2000 National Fusarium Head Blight Forum. Kinko's, Okemos, MI.
This article has been cited by other articles:

|
 |

|
 |
 
J.-B. Yu, G.-H. Bai, S.-B. Cai, Y.-H. Dong, and T. Ban
New Fusarium Head Blight-Resistant Sources from Asian Wheat Germplasm
Crop Sci.,
May 1, 2008;
48(3):
1090 - 1097.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. C.Y Collard and D. J Mackill
Marker-assisted selection: an approach for precision plant breeding in the twenty-first century
Phil Trans R Soc B,
February 12, 2008;
363(1491):
557 - 572.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. X. Zhang, Y. Jin, J. C. Rudd, and H. E. Bockelman
New Fusarium Head Blight Resistant Spring Wheat Germplasm Identified in the USDA National Small Grains Collection
Crop Sci.,
January 16, 2008;
48(1):
223 - 235.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Anderson, S. Chao, and S. Liu
Molecular Breeding Using a Major QTL for Fusarium Head Blight Resistance in Wheat
Crop Sci.,
December 18, 2007;
47(Supplement_3):
S-112 - S-119.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. O. Pumphrey, R. Bernardo, and J. A. Anderson
Validating the Fhb1 QTL for Fusarium Head Blight Resistance in Near-Isogenic Wheat Lines Developed from Breeding Populations
Crop Sci.,
January 22, 2007;
47(1):
200 - 206.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. D. Subedi, B. L. Ma, and A. G. Xue
Planting Date and Nitrogen Effects on Fusarium Head Blight and Leaf Spotting Diseases in Spring Wheat
Agron. J.,
January 1, 2007;
99(1):
113 - 121.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Hill-Ambroz, C. A. Webb, A. R. Matthews, W. Li, B. S. Gill, and J. P. Fellers
Expression Analysis and Physical Mapping of a cDNA Library of Fusarium Head Blight Infected Wheat Spikes
Crop Sci.,
November 1, 2006;
46(Supplement_1):
S-15 - S-26.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. B. Adhikari, H. Wallwork, and S. B. Goodwin
Microsatellite Markers Linked to the Stb2 and Stb3 Genes for Resistance to Septoria Tritici Blotch in Wheat
Crop Sci.,
July 1, 2004;
44(4):
1403 - 1411.
[Abstract]
[Full Text]
[PDF]
|
 |
|