Crop Science 43:388-393 (2003)
© 2003 Crop Science Society of America
GENOMICS, MOLECULAR GENETICS & BIOTECHNOLOGY
Molecular Mapping of Leaf Rust Resistance Gene Rph5 in Barley
J. A. Mammadova,
J. C. Zwonitzerb,
R. M. Biyasheva,
C. A. Griffeya,
Y. Jind,
B. J. Steffensonc and
M. A. Saghai Maroof*,a
a Crop & Soil Environmental Sciences Dep., Virginia Tech, Blacksburg, VA 24061
b The Samuel Roberts Noble Foundation, 2510 Sam Noble Parkway, Ardmore, OK 73401
c Dep. of Plant Pathology, Univ. of Minnesota, St. Paul, MN 55108-6030
d Plant Science Dep., South Dakota State Univ., Brookings, SD 57007
* Corresponding author (smaroof{at}vt.edu)
 |
ABSTRACT
|
|---|
Leaf rust caused by Puccinia hordei G. Otth is an important disease of barley (Hordeum vulgare L.) in many regions of the world. Yield losses up to 32% have been reported in susceptible cultivars. The Rph5 gene confers resistance to the most prevalent races (8 and 30) of barley leaf rust in the USA. Therefore, the molecular mapping of Rph5 is of great interest. The objectives of this study were to map Rph5 and identify closely linked molecular markers. Genetic studies were performed by analysis of 93 and 91 F2 plants derived from the crosses ‘Bowman’ (rph5) x ‘Magnif 102’ (Rph5) and ‘Moore’ (rph5) x Virginia 92-42-46 (Rph5), respectively. Bulk segregant analysis (BSA) using amplified fragment length polymorphism (AFLP), restriction fragment length polymorphism (RFLP), and simple sequence repeat (SSR) markers was conducted. Linkage analysis positioned the Rph5 locus to the extreme telomeric region of the short arm of barley chromosome 3H at 0.2 centimorgans (cM) proximal to RFLP marker VT1 and 0.5 cM distal from RFLP marker C970 in the Bowman x Magnif 102 population. Map positions and the relative order of the markers were confirmed in the Moore x Virginia 92-42-46 population. RFLP analysis of the near isogenic line (NIL) Magnif 102/*8Bowman, the susceptible recurrent parent Bowman, and Rph5 donor Magnif 102, confirmed the close linkage of the markers VT1, BCD907, and CDO549 to Rph5. Results from this study will be useful for marker-assisted selection and gene pyramiding in programs breeding for leaf rust resistance and provide the basis for physical mapping and further cloning activities.
Abbreviations: AFLP, amplified fragment length polymorphism • BSA, bulk segregant analysis • CAPS, cleaved amplified polymorphic sequence • cM, centimorgan • NIL, near isogenic line • RFLP, restriction fragment length polymorphism • SSR, simple sequence repeat • STS, sequenced tagged site
|
INTRODUCTION
|
|---|
LEAF RUST caused by P. hordei is generally considered the most important rust disease of barley on a worldwide basis. Severe yield losses have been observed in Australia (31%) (Coterill et al., 1992) and Europe (17–31%) (King and Polley, 1976). In the USA, a 32% yield reduction was reported for susceptible cultivars under epidemic conditions in Virginia (Griffey et al., 1994).
Clifford (1985) listed two types of resistance against P. hordei in barley: partial resistance and race-specific resistance. Partial resistance is controlled by several to many genes and is generally considered more durable than the race-specific resistance (Qi et al., 2000; Kicherer et al., 2000). However, the quantitative expression of this trait and complex genetics make this type of resistance more difficult to use in breeding programs. Race-specific resistance is usually governed by single dominant genes. Although race-specific leaf rust resistance genes have not provided durable protection, they can be easily identified and transferred into appropriate germplasm (Parlevliet, 1976). To date, 16 major race-specific genes (designated as Rph1 to Rph16) for leaf rust resistance have been identified (Franckowiak et al., 1997; Ivandic et al., 1998).
Development of disease resistant barley cultivars has been the most efficient way to control leaf rust (Mathre, 1997; Zillinsky, 1983). The pyramiding of multiple Rph genes is expected to increase the durability of leaf rust resistance in cultivars. Although virulence for Rph5 is widely prevalent in Europe (Parlevliet, 1976) and South America (Brodny and Rivadeneira, 1996; Fetch et al., 1998), it has not been identified in North America. Thus, Rph5 could be used to protect barley cultivars from leaf rust damage in North America. However, a more sound gene deployment strategy would be to use this gene in combination with other effective genes such as Rph3 and Rph9 (Brooks et al., 2000).
Most of the known barley leaf rust resistance genes have been described and mapped by means of morphological characters, biochemical markers, and cytogenetic stocks (Table 1). However, so far only five Rph genes have been mapped by means of molecular markers. Two alleles at the Rph9 locus, Rph9.i and Rph9.z (formerly designated as Rph12), were located on chromosome 5H using RFLP and sequence tagged site (STS) markers (Borovkova et al., 1997, 1998). STS and cleaved amplified polymorphic sequence (CAPS) markers were employed to map Rph16 onto barley chromosome 2H (Ivandic et al., 1998). Recently, Rph7 was mapped onto the short arm of chromosome 3H by means of RFLP markers (Brunner et al., 2000; Graner et al., 2000). Finally, Rph6 has been mapped onto chromosome 3HS (Steffenson, unpublished). The precise chromosomal position of Rph5 is not known, although the gene was assigned to chromosome 3H by trisomic analysis (Tan, 1978; Tuleen and McDaniel, 1971). Thus, the objectives of this study were to map Rph5 by means of molecular markers and develop closely linked markers for marker-assisted selection.
|
MATERIALS AND METHODS
|
|---|
Genetic Materials
Two F2 populations derived from crosses Bowman (PI 483237) x Magnif 102 (PI 337140) and Moore (CI 7251) x Virginia 92-42-46 (hereafter, referred to as BM and MV populations, respectively) and consisting of 93 and 91 individuals, respectively, were used for molecular mapping. Magnif 102 (Franckowiak et al., 1997) and Virginia 92-42-46 (Zwonitzer, 1999) carry Rph5 and provide the genetic sources of resistance to leaf rust in this experiment. To confirm the close linkage between Rph5 and flanking markers, the near isogenic line (NIL) Magnif 102/*8Bowman, together with recurrent parent Bowman and Rph5 donor Magnif 102, were used in this study. Seeds of the NIL were kindly provided by Dr. J.D. Franckowiak at North Dakota State University, Fargo.
Disease Screening
To determine infection type (disease reaction phenotype), F2 plants from both populations were inoculated with race 8 as described by Brooks et al. (2000). To confirm the genotype for resistance in F2 plants (i.e., whether Rph5/Rph5, Rph5/rph5, rph5/rph5), 50 seeds from each F2:3 family were planted, inoculated, and evaluated for their leaf rust reaction. A set of host differential lines including ‘Sudan’ (Rph1), ‘Peruvian’ (Rph2), ‘Aim’ (Rph3), ‘Estate’ (Rph3), ‘Gold’ (Rph4), ‘Bolivia’ (Rph2 +Rph6), ‘Cebada Capa’ (Rph7), ‘Egypt 4’ (Rph8), ‘Hor 2596’ (Rph9.i), ‘Triumph’ (Rph9.z), ‘Clipper BC8’ (Rph10), ‘Clipper BC67’ (Rph11), Berac*3/HS2986 (Rph13), ‘PI 531901-1’ (Rph14) and Bowman*4/PI 3555447 (Rph15) were included as checks in the experiments. The virulence/avirulence formula of race 8 is Rph1, 4, 8, 10, 11/Rph2, 3, 5, 2+6, 7, 9.i, 9.z, 13, 14, 15 (Griffey et al., 1994). Infection types were scored by the 0-to-4 scale of Levine and Cherewick (1952). Infection types of 0, 1, or 2 were considered indicative of host resistance, whereas infection types 3 or 4 were considered indicative of host susceptibility. Disease assessments were performed 10 to 14 d after inoculation. Infection types of F2 progeny were compared with infection types of the parental lines and host-differentials to assure proper scoring and assignment into resistant and/or susceptible classes.
Molecular Mapping
Genomic DNA from 91 individual MV F2 plants and 93 BM F2:3 families was processed for molecular marker analysis. DNA was extracted from freeze-dried leaf tissue as described by Saghai Maroof et al. (1984). For BSA (Michelmore et al., 1991), DNA from six MV F2 individuals identified as homozygous resistant or homozygous susceptible, on the basis of F2:3 disease phenotype data, as well as six BM F2:3 homozygous resistant and homozygous susceptible families were pooled to form resistant and susceptible bulks. For RFLP analysis, DNA samples from the susceptible and resistant bulks, parental samples, NIL Magnif 102/*8Bowman, and 91 individual MV F2 plants and 93 BM F2:3 families were digested with six restriction enzymes BamHI, DraI, EcoRI, HindIII, SstI, and XbaI according to the manufacturer's protocol (Gibco BRL, Rockville, MD). RFLP analysis was performed as previously described (Biyashev et al., 1997).
In addition to RFLP analysis, a set of microsatellite markers was used for mapping purposes. PCR amplification and microsatellite analysis were carried out according to published procedures (Liu et al., 1996; Ramsey et al., 2000). AFLP analysis was conducted following the protocol described previously (Vos et al., 1995; Maughan et al., 1996). Conversion of AFLP markers to RFLP markers was performed as described by Upender et al. (1995) and Hayes and Saghai Maroof (2000).
Sequence Analysis
DNA was sequenced with an ABI 377 DNA sequencer (Applied Biosystems, Foster City, CA). Plasmid template was prepared by standard alkaline-lysis method followed by purification with QiaexII (Qiagen Inc., Valencia, CA). Dye-terminator cycle sequencing was done on the basis of the manufacturer's protocols (Perkin Elmer, Foster City, CA). Sequence analysis, including primer design was conducted with Lasergene software (DNASTAR, Madison, WI).
Linkage Analysis
The computer program MAPMAKER version 3.0b was used for genetic mapping and linkage analysis (Lander et al., 1987). Linkage maps were constructed on the basis of a LOD threshold of 3.0 and maximum Haldane distance of 50 cM.
|
RESULTS
|
|---|
In both crosses, the number of resistant and susceptible F2 progeny approximated a 3:1 ratio, indicating that a single dominant gene (Rph5) conferred resistance in Magnif 102 and Virginia 92-42-46 (Table 2). This result was confirmed by the 1:2:1 ratio of homozygous resistant, segregating, homozygous susceptible F2:3 families (Table 2). Infection types of resistant parents and resistant progeny are summarized in Table 3.
Trisomic analysis of Tuleen and McDaniel (1971) and Tan (1978) indicated that Rph5 was located on barley chromosome 3H. Therefore, we selected previously reported RFLP and SSR markers from chromosome 3H for BSA. Six RFLP markers (CDO549, BCD907, C970, MWG2021, MWG848, and TAG683) in the BM population were mapped in the vicinity of the Rph5 locus (Fig. 1A). RFLP clone MWG691, originally mapped to the telomeric region of barley chromosome 3HS (Graner et al., 1994), was monomorphic in the BM population. To map MWG691, we converted it into a PCR-based marker. An insert fragment of 290 bp from the MWG691 clone was sequenced. The sequence information was used to design a pair of primers (5'gatcacttggggccgtatgtgtta3' and 5'aattccgggtgagtgcctcttc 3') to PCR amplify the DNA from parental forms and bulk segregants of both populations. As a PCR-based marker, MWG691 revealed polymorphism between Bowman and Magnif 102. In the BM F2 population, this marker segregated in a codominant fashion and was mapped 0.9 cM proximal to Rph5. Map positions and the relative order of the markers CDO549, BCD907, MWG2021, MWG848 were confirmed on the MV population (Fig. 1B). In addition to the above-mentioned markers, two RFLP markers, MWG2158 and MWG2266, were mapped 1.5 and 1.9 cM proximal to Rph5, respectively, in this population.
View larger version (14K):
[in this window]
[in a new window]
|
Fig. 1. Partial molecular maps of barley chromosome 3H showing the genetic location of leaf rust resistance gene Rph5. Markers were mapped in two segregating populations: (A) Bowman (rph5) x Magnif 102 (Rph5); (B) Moore (rph5) x Virginia 92-42-46 (Rph5), respectively. Map distances are given in centimorgans (cM).
|
|
To identify more closely linked markers, AFLP analysis on parental lines and bulks from both populations was conducted. As a result, an AFLP fragment of 120 bp was detected with the primer combination Eco+ACA/Mse+AGG in both populations. This AFLP marker was converted to an RFLP probe (hereafter, referred to as VT1) and mapped 0.2 cM distal to Rph5 in both populations. Also, an AFLP (E06M10) fragment of 200 bp was detected with the primer combination Eco+AGA/Mse+ATA and mapped to the most telomeric region of barley chromosome 3HS 3.7 cM distal from Rph5 in the BM population. This DNA fragment was cloned and sequenced. A BLAST search detected high similarity with the wheat telomere-specific DNA fragment (GenBank accession #AF004950).
The close linkage of the RFLP markers flanking Rph5 was confirmed by RFLP analysis of NIL Magnif 102/*8Bowman, recurrent parent Bowman and the Rph5 donor Magnif 102 as well as the other known source of Rph5 ‘Quinn’ (PI39401). The markers VT1, BCD907 and CDO549 detected DNA fragments of the same size in NIL Magnif 102/*8Bowman, Magnif 102 and Quinn, while a different size fragment was observed in Bowman. As an example, RFLP patterns with the VT1 marker is shown in Fig. 2. In total, 16 RFLPs, four SSRs, and one AFLP marker were placed on chromosome 3H in the BM population, and 15 RFLP and five SSR markers were mapped on the same linkage group in the MV population. Established maps share 13 common markers, including 10 RFLPs and three microsatellites, and cover 172.7 and 105.8 cM of the barley chromosome 3H in BM and MV populations, respectively (whole chromosome 3H maps are not shown).
View larger version (92K):
[in this window]
[in a new window]
|
Fig. 2. RFLP analysis of Bowman (rph5), the NIL Magnif 102/8*Bowman (Rph5), Magnif 102 (Rph5) and Quinn (Rph5 and Rph2) with VT1.
|
|
|
DISCUSSION
|
|---|
With two segregating populations, the leaf rust resistance gene Rph5 was precisely mapped to the extreme telomeric region of chromosome 3HS by means of molecular markers. Mapping results were confirmed by NIL analysis. Several closely linked molecular markers were identified for Rph5. In the BM cross, the bracketing markers are VT1 (at 0.2 cM distal) and C970 (at 0.5 cM proximal) and in the MV cross, VT1 (also at 0.2 cM distal) and MWG2158 (at 1.2 cM proximal) (Fig. 1A and B). The closely linked markers, identified in this study, may be useful as probes for detecting the barley lines carrying resistance alleles of Rph5. The other benefit derived from comprehensive mapping is the possibility of positional cloning of Rph5 in the future. One of the most crucial steps in positional cloning is the discovery of molecular markers bracketing the gene of interest as demonstrated here for Rph5. Map-based cloning has been successfully applied for several disease resistance genes in barley (Buschges et al., 1997; Wei et al., 1999).
As was mentioned above, the Rph7 locus was also mapped to the extreme telomeric region of barley chromosome 3HS (Brunner et al., 2000; Graner et al., 2000). Interestingly, this part of chromosome 3HS does show an increased recombination rate that indicates a relatively high level of genetic activity in the region (Kunzel et al., 2000). The availability of molecular maps with common markers allowed comparison of map positions and estimation of relative locations of other loci. In this study, we compared three molecular maps of the Rph5 and Rph7 flanking regions: two of the maps were developed in this study and the third by Brunner et al. (2000). On the basis of the positions of common markers, we estimate that Rph5 is located about 6 cM distally from Rph7 on barley chromosome 3HS (Fig. 3).
View larger version (23K):
[in this window]
[in a new window]
|
Fig. 3. Estimation of the relative locations of Rph5 and Rph7 leaf rust resistance genes on the basis of comparison of three maps with common markers. Maps of Moore x Virginia 92-42-46 and Bowman x Magnif 102 are from this study, and Cebada Capa x Bowman map was published recently (Brunner et al., 2000).
|
|
Another interesting finding is the positioning of the AFLP marker E06M10 on the extreme telomeric region of chromosome 3HS. It was mapped 3.3 cM distal to the RFLP markers CDO549 and BCD907 in the BM cross. Sequence analysis of the DNA fragment detected by E06M10 revealed a high level of similarity with wheat telomere-associated DNA (GenBank accession #AF004950). In this regard, it is interesting to note that Kilian et al. (1999) generated marker Tel3S from a telomere-associated sequence of barley and mapped it to the most terminal region of barley chromosome 3HS, which is located 
4.5 cM away from the MWG691/ABG316A cluster. In our map, the distance between MWG691 and E06M10 is approximately the same—4.6 cM (Fig. 1A). This observation confirmed the position of marker Tel3S in the terminal region of barley chromosome 3HS.
Precise mapping of Rph5 has resulted in the identification of closely linked molecular markers that are potentially suitable for marker-assisted selection and pyramiding of genes confirming more durable resistance to leaf rust. Also, the results provide the basis for physical mapping and map-based cloning of the Rph5 gene.
|
ACKNOWLEDGMENTS
|
|---|
This study was supported in part by the North American Barley Genome Mapping Project and the Virginia Small Grains Board. The authors thank Dr. A. Graner for providing the RFLP markers.
Received for publication August 12, 2001.
|
REFERENCES
|
|---|
- Biyashev, R.M., R.A. Ragab, P.J. Maughan, and M.A. Saghai Maroof. 1997. Molecular mapping, chromosomal assignment, and genetic diversity analysis of phytochrome loci in barley (Hordeum vulgare). J. Hered. 88:21–26.[Abstract/Free Full Text]
- Borovkova, I.G., Y. Jin, and B.J. Steffenson. 1998. Chromosomal location and genetic relationship of the leaf rust resistance genes Rph9 and Rph12 in barley. Phytopathology 88:76–80.
- Borovkova, I.G., Y. Jin, B.J. Steffenson, A. Kilian, T.K. Blake, and A. Kleinhofs. 1997. Identification and mapping of leaf rust resistance gene in barley line Q21861. Genome 40:236–241.
- Brodny, U., and M. Rivadeneira. 1996. Physiological specialization of Puccinia hordei in Israel and Ecuador: 1992 to 1994. Can. J. Plant Pathol. 18:375–378.
- Brooks, W.S., C.A. Griffey, B.J. Steffenson, and H.E. Vivar. 2000. Genes governing resistance to Puccinia hordei in thirteen spring barley accessions. Phytopathology 90:1131–1136.
- Brunner, S., B. Keller, and C. Feuillet. 2000. Molecular mapping of the Rph7.g leaf rust resistance gene in barley (Hordeum vulgare L.). Theor. Appl. Genet. 101:783–788.
- Buschges R., K. Hollricher, R. Panstruga, G. Simons, M. Wolter, A. Frijters, R. van Daelen, T. van der Lee, P. Diergaarde, J. Groenendijk, S. Topsch, P. Vos, F. Salamini, and P. Schulze-Lefert. 1997. The barley Mlo gene: A novel control element of plant pathogen resistance. Cell 88:695–705.[ISI][Medline]
- Clifford, B.C. 1985. Barley leaf rust. p. 173–205. In A.P. Roelfs and W.R. Bushnell (ed.) Cereal rust. Vol. 2, Diseases, distribution, epidemiology, and control. Academic Press, New York.
- Coterill, P.J., R.G. Rees, and W.A. Vertigan. 1992. Detection of Puccinia hordei virulent on the Pa9 and ‘Triumph’ resistance genes in barley in Australia. Aust. Plant Pathol. 21:32–34.
- Fetch, T.G., B.J. Steffenson, and Y. Jin. 1998. Worldwide virulence of Puccinia hordei on barley (Abstr.). Phytopathology 88:S28.
- Feuerstein, U., A.H.D. Brown, and J.J. Burdon. 1990. Linkage of rust resistance genes from wild barley (Hordeum spontaneum) with isozyme markers. Plant Breed. 104:318–324.
- Franckowiak, J.D., Y. Jin, and B.J. Steffenson. 1997. Recommended allele symbols for leaf rust resistance genes in barley. Barley Genet. Newsl. 27:36–44.
- Graner, A., E. Bauer, A. Kellermann, S. Kirchner, J.K. Muraya, A. Jahoor, and G. Wenzel. 1994. Progress of RFLP-map construction in winter barley. Barley Genet. Newsl. 23:53–59.
- Graner, A., S. Streng, A. Drescher, Y. Jin, I. Borovkova, and B.J. Steffenson. 2000. Molecular mapping of the leaf rust resistance gene Rph7 in barley. Plant Breed. 119:389–392.
- Griffey, C.A., M.K. Das, R.E. Baldwin, and C.M. Waldenmaier. 1994. Yield losses in winter barley resulting from a new race of Puccinia hordei in North America. Plant Dis. 78:256–260.
- Hayes, A.J., and M.A. Saghai Maroof. 2000. Targeted resistance gene mapping in soybean using modified AFLPs. Theor. Appl. Genet. 100:1279–1283.
- Ivandic, V., U. Walther, and A. Graner. 1998. Molecular mapping of a new gene in wild barley conferring complete resistance to leaf rust (Puccinia hordei Otth). Theor. Appl. Genet. 97:1235–1239.
- Jin, Y., G.D. Statler, J.D. Franckowiak, and B.J. Steffenson. 1993. Linkage between leaf rust resistance genes and morphological markers in barley. Phytopathology 83:230–233.
- Kicherer, S., G. Backes, U. Walther, and A. Jahoor. 2000. Localizing QTLs for leaf rust resistance and agronomic traits in barley (Hordeum vulgare L.). Theor. Appl. Genet. 100:881–888.
- Kilian, A., D. Kudra, and A. Kleinhofs. 1999. Genetic and molecular characterization of barley chromosome telomeres. Genome 42:412–419.
- King, K.E., and R.W Polley. 1976. Observations on the epidemiology and effect on grain yield of brown rust in spring barley. Plant Pathol. 25:63–73.
- Kunzel, G., L. Korzun, and A. Meister. 2000. Cytologically integrated physical restriction fragment length polymorphism maps for the barley genome based on translocation breakpoints. Genetics 154:397–412.[Abstract/Free Full Text]
- Lander, E.S., P. Green, J. Abrahamson, A. Barlow, J.M. Daly, S.E. Lincoln, and L. Newberg. 1987. MAPMAKER: An interactive computer package for constructing primary genetic linkage maps of experimental and natural populations. Genomics 1:174–181.[Medline]
- Levine, M.N., and W.J. Cherewick. 1952. Studies on dwarf leaf rust of barley. U.S. Department of Agric. Tech. Bull. No. 1056, Washington, DC.
- Liu, Z.-W., R.M. Biyashev, and M.A. Saghai Maroof. 1996. Development of simple sequence repeat DNA and their integration into a barley linkage map. Theor. Appl. Genet. 93:869–876.
- Mathre, D.E. 1997. Diseases caused by fungi. p. 32–41. In D.E. Mathre (ed.) Compendium of barley diseases. The Am. Phytopathological Soc., St. Paul, MN.
- Maughan, P.J., M.A. Saghai Maroof, G.R. Buss, and G.M. Huestis. 1996. Amplified fragment length polymorphism (AFLP) in soybean: species diversity, inheritance, and near-isogenic line analysis. Theor. Appl. Genet. 96:331–338.
- Michelmore, R.W., I. Paran, and R.V. Kesseli 1991. Identification of markers linked to disease-resistance genes by bulked segregant analysis: A rapid method to detect markers in specific genomic regions by using segregating populations. Proc. Natl. Acad. Sci. (USA) 88:9828–9832.[Abstract/Free Full Text]
- Parlevliet, J.E. 1976. The genetics of seedling resistance to leaf rust, Puccinia hordei Otth in some spring barley cultivars. Euphytica 25:249–254.
- Qi, X., F. Fekadu, D. Sijtsma, R.E. Niks, P. Lindhout, and P. Stam. 2000. The evidence for abundance of QTLs for partial resistance to Puccinia hordei on the barley genome. Mol. Breed. 6:1–9.
- Ramsay, L., M. Macaulay, S. degli Ivanissevich, K. MacLean, L. Cardle, J. Fuller, K.J. Edwards, S. Tuvesson, M. Morgante, A. Massarie, E. Maestri, N. Marmiroli, T. Sjakste, M. Ganalg, W. Powell, and R. Waugh. 2000. A simple sequence repeat-based linkage map of barley. Genetics 156:1997–2005.[Abstract/Free Full Text]
- Saghai Maroof, M.A., K.M. Soliman, R.A. Jorgensen, and R.W. Allard. 1984. Ribosomal DNA spacer-length polymorphisms in barley: Mendelian inheritance, chromosomal location, and population dynamics. Proc. Natl. Acad. Sci. (USA) 81:8014–8018.[Abstract/Free Full Text]
- Tan, B.H. 1978. Verifying the genetic relationships between three leaf rust resistance genes in barley. Euphytica 27:317–323.
- Tuleen, N.A., and M.E. McDaniel. 1971. Location of genes Pa and Pa5. Barley Newsl. 15:106–107.
- Upender, M.M., L. Raj, and M. Weir. 1995. Rapid method for elution and analysis of PCR products separated on high-resolution polyacrylamide gels. Biotechniques 18:33–34.
- Vos, P., R. Hogers, M. Bleeker, M. Reijans, T. van de Lee, M. Hornes, A. Frijters, J. Pot, J. Peleman, M. Kuiper, and M. Zabeau. 1995. AFLP: A new technique for DNA fingerprinting. Nucleic Acids Res. 23:4407–4414.[Abstract/Free Full Text]
- Wei, F., K. Gobelman-Werner, S.M. Morroll, J. Kurth, L. Mao, R. Wing, D. Leister, P. Schultze-Lefert, and R.P. Wise. 1999. The Mla (powdery mildew) resistance cluster is associated with three NBS-LRR gene families and suppressed recombination within a 240-kb DNA interval on chromosome 5S (1HS) of barley. Genetics 153:1929–1948.[Abstract/Free Full Text]
- Zilinsky, F.J. 1983. Common diseases of small grain cereals: A guide to identification. p. 11–16. The International Maize and Wheat Improvement Center, Mexico.
- Zwonitzer, J.C. 1999. Identification and mapping of a resistance gene to barley leaf rust (Puccinia hordei G. Otth). M.S. Thesis. Virginia Tech, Blacksburg, VA.
TOP
ABSTRACT
INTRODUCTION
