Crop Science
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (17)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tar'an, B.
Right arrow Articles by Pauls, K. P.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Tar'an, B.
Right arrow Articles by Pauls, K. P.
Agricola
Right arrow Articles by Tar'an, B.
Right arrow Articles by Pauls, K. P.
Related Collections
Right arrow Other Legumes
Right arrow Crop Genetics
Crop Science 42:544-556 (2002)
© 2002 Crop Science Society of America

CELL BIOLOGY & MOLECULAR GENETICS

Genetic Mapping of Agronomic Traits in Common Bean

Bunyamin Tar'an, Thomas E. Michaels and K. Peter Pauls*

Plant Biotechnology Division, Dep. of Plant Agriculture, Univ. of Guelph, Guelph, ON, Canada, N1G 2W1

* Corresponding author (ppauls{at}uoguelph.ca)


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
SBreeding effort to improve yield and other quantitative traits in common bean (Phaseolus vulgaris L.) has proven to be difficult. The use of molecular markers will improve our understanding of the genetic factors conditioning these traits and is expected to assist in the selection of superior genotypes. This study was conducted to identify genetic loci associated with 14 quantitative traits responsible for seed yield, yield components, and plant architecture traits in common bean. A population of 142 F2:4 lines that was developed from a cross between OAC Seaforth and OAC 95-4, was evaluated at two locations in Canada in 1998. The lines were assayed for random amplified polymorphic DNA (RAPD), restriction fragment length polymorphism (RFLP), simple sequence repeat (SSR), and amplified fragment length polymorphism (AFLP) markers. One hundred fourteen markers were assigned to 12 linkage groups. Growth habit and resistance to common bacterial blight [CBB, caused by Xanthomonas axonopodis pv. phaseoli (Smith) Vauterin, Hoste, Kosters & Swings = syn. X. campestris pv. phaseoli (Smith) Dye] were each mapped as single major genes on linkage groups G11 and G5, respectively. An alignment of the current map with the previous linkage map developed at the University of Florida and the core linkage map of bean was produced from 30 RFLP loci. Twenty quantitative trait loci (QTL) were identified for the 14 traits that were analyzed. The number of QTL identified per trait ranged from one to three. A multiple QTL model for each trait showed that these genomic regions accounted for 11.3 to 43.1% of the total phenotypic variation for the traits. Five of the twenty QTL were detected at both locations. The strengths of QTL effects for a given trait appeared to be slightly different among locations, but the positions of QTL on the map were stable across locations.

Abbreviations: AFLP, amplified fragment length polymorphism • CBB, common bacterial blight • cM, centimorgan • GH, growth habit • LOD, logarithmic of odds ratio • MAS, marker-assisted selection • QTL, quantitative trait loci • RAPD, random amplified polymorphic DNA • RFLP, restriction fragment length polymorphism • SCAR, sequence characterized amplified region • SSR, simple sequence repeat


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
SELECTION FOR YIELD and other agronomic traits, including resistance to biotic and abiotic stresses, upright plant architecture, growth habit, lodging resistance, and maturity has been extensively utilized by bean breeders to develop cultivars with superior performance or to develop cultivars that are adapted to specific environments and/or cropping systems (Acquaah et al., 1991; Brothers and Kelly, 1993; Kelly et al., 1998; Nienhuis and Singh, 1986; Schneider et al., 1997; Scully et al., 1991; Singh, 1994; Singh and Muñoz, 1999). However, complex inheritance patterns and strong environmental effects may limit the value of phenotypic estimates of these traits. Furthermore, inverse correlations among these traits may hinder the progress of plant improvement. The use of molecular markers will improve our understanding of the genetic factors conditioning complex traits since these factors can be localized to specific regions of the genome, and their effects can be estimated individually. In addition, the use of molecular markers is expected to assist in the selection of superior genotypes.

Common bean (2n = 2x = 22) has the estimated size of genome of 637 Mbp or 0.66 pg/1C (Arumuganathan and Earle, 1991). Several bean molecular linkage maps have been constructed (Adam-Blondon et al., 1994; Jung et al., 1996, 1997; Nodari et al., 1993; Vallejos et al., 1992). On the basis of the shared RFLP markers among these maps, Freyre et al. (1998) integrated information from several maps into a core linkage map for bean. Other studies identified specific markers for disease resistance (Adam-Blondon et al., 1994; Ariyarathne et al., 1999; Bai et al., 1997; Haley et al., 1993; Johnson et al., 1995; Jung et al., 1997; Miklas et al., 1996, 1998, 2001; Nodari et al., 1993; Park et al., 1999a; Schneider et al., 2001; Young and Kelly, 1997; Yu et al., 1998), morphological traits (Jung et al., 1996; Park et al., 1999b), seed size (Park et al., 2000), canning quality (Walters et al., 1997), tolerance to drought stress (Schneider et al., 1997), and characters that are affected by domestication processes in common bean (Koinange et al., 1996). Only few of these traits have been integrated into the core map for common bean (Freyre et al., 1998; Gepts, 1999).

In the present study, we examined the genetic loci associated with 14 quantitative traits responsible for seed yield, plant architecture, and plant development. These traits are important to all common bean breeding programs in the world. The current study also provided estimates of the minimum number of QTL affecting each trait, identified the chromosomal locations of these loci, estimated the magnitudes of the effects for each QTL and tested the robustness of these QTL across environments. Connections between the linkage map developed in this study with the bean core map were also made.


    MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Population
The population used in this study was developed from a cross between two inbred lines, OAC Seaforth and OAC 95-4. These parents differed for traits, including seed yield, seed size, growth habit, days to flowering, and days to maturity (Table 1). Unselected individual F2 plants were self pollinated in a nursery in New Zealand to produce 142 F2:3 lines in the winter of 1997. The F2:3 seeds were grown at the Elora Research Station in Ontario in 1997. The plants within a row were harvested and bulked to produce F2:4 lines.


View this table:
[in this window]
[in a new window]
 
Table 1. Description of the quantitative traits responsible for seed yield, yield components, and plant architectural traits measured on 142 F2:4 lines derived from a cross between OAC Seaforth and OAC 95-4 of common bean.

 
Field Design
The 142 F2:4 lines and both parents were evaluated in a 12-by-12 simple lattice with two-row plots at the Elora Research Station (2550 Corn Heat Units) and the Woodstock Research Station (2850 Corn Heat Units) in Ontario, Canada, in 1998. The soil type at both locations is silt loam with the total precipitation during the growing season (from May–August 1998) was 189 and 248 mm for Elora and Woodstock, respectively. The plant rows were 6 m long and spaced 60 cm apart. The plots were machine-planted at a density of 80 seeds per row. The fertility and cultivation regimes were consistent with the optimum bean production practices for these regions. During the maturation stage (R9; Michaels, 1991), 50 cm from both ends of the plant rows were trimmed leaving 5-m rows for data collection.

Data on yield components and other morphological traits (Table 1) were collected by sampling 15 plants per row at physiological maturity (90% of the pods were yellow-green to brown). Data on growth habit, days to flowering, days to maturity, lodging, and seed yield were based on evaluation of all the plants in a row.

DNA Isolation
Twenty-four seeds of each F2:4 line, OAC Seaforth, and OAC 95-4 were planted in a growth room. An equal quantity of fresh leaf tissue from an average of 20 plants of each line were harvested at the first trifoliate leaf stage. Genomic DNA was isolated following the CTAB method with minor modification (Doyle and Doyle, 1990).

RFLP Assay
Bean genomic clones (kindly provided by Dr. J. Tohme of the Biotechnology Unit, CIAT, Cali, Colombia) were hybridized to restriction enzyme digested (BamHI, DraI, EcoRI, EcoRV, HindIII, PstI, PvuI, and SmaI) parental DNAs to identify clone–enzyme combinations that resulted in polymorphic patterns. The restriction enzyme that gave the clearest RFLP for a particular clone was used to digest the DNA samples from each of the 142 F2:4 lines.

The clones used to probe the Southern blots were labeled with Digoxigenin (DIG) (Boehringer Mannheim, Laval, QC, Canada). Hybridization and washing steps were performed following manufacturer's instruction. The membrane was placed in contact with X-ray film for approximately 40 min prior to development. The RFLP markers were named following the previous nomenclature that consisted of three letters (BNG) followed by the serial number of the clones (Vallejos et al., 1992). In addition, the enzyme that was used to cut the genomic DNA was also included for each clone.

RAPD, AFLP, SCAR, and SSR Assays
The RAPD procedure was the same as described in Bai et al. (1997). The RAPD markers were named according to their primer names designated at the University of British Columbia or Operon Technologies Inc. (Alameda, CA) and the molecular weight of the band.

The AFLP analysis was performed essentially as described in the AFLP Plant Mapping Kit protocol (Perkin Elmer, Foster City, CA; Part #402083) except that the selective amplification was done with nonfluorescently labeled EcoRI and MseI primers. The selective amplifications products were then loaded onto a 6% (w/v) denaturing polyacrylamide gel. The gel was run in 1x TBE at 40 W for 4 h and silver-stained following the protocols described by Bassam et al. (1991). AFLP marker nomenclature was designed to facilitate marker transfer among laboratories. The first three letters represent the EcoRI + 3 selective nucleotides. The second three letters represent the MseI + 3 selective nucleotides. The number following these six letters is the size of the polymorphic amplified fragment for a given primer pair.

The primer sequence for the SCARxan-700 was kindly provided by Dr. S. Beebe (CIAT, Cali, Colombia). The marker was linked to common bacterial blight resistance in XAN 159 line (S. Beebe, 1998, personal communication). The forward and reverse sequences of this primer are 5' ttttgtatgtgtttctctggtgtag 3' and 5' atctcttttatccctcctttgtgtg 3', respectively. The amplification was done at the annealing temperature of 58°C with the following reaction mixture: 50 ng of bean genomic DNA, 1 mM of MgCl2, 0.15 µM each of forward and reverse primers, 200 µM each of dNTPs, 10x PCR buffer (Gibco BRL, Life Tech.), and 1 U of Taq Polymerase (Gibco BRL, Life Tech.).

The primer sequences (Table 2) for the SSR assays were kindly provided by Dr. Kangfu Yu, Agriculture and Agrifood Canada, Greenhouse and Processing Crops Centre, Harrow, ON. The PCR amplifications were done in a PTC-100 Thermocycler (MJ Research Inc., Watertown, MA). The 15-µL PCR mixture used for the SSR assay contained 25 ng of bean genomic DNA, 1 mM of MgCl2, 0.15 µM each of forward and reverse primers, 200 µM each of dNTP, 10x PCR buffer (Gibco BRL, Life Tech.), and 1 U of Taq Polymerase (Gibco BRL, Life Tech.). The amplification process was performed for 35 cycles with the following temperature profile: 94°C for 30 s, (47–50)°C for 30 s, and 68°C for 1 min. A total of 7.5 µL of PCR products were separated on a 10% (w/v) polyacrylamide gel run at 50 W for 3 h. The gels were stained with silver nitrate to visualize the fragments (Bassam et al., 1991). The SSR loci (Table 2) were named following the nomenclature described previously in Yu et al. (1999).


View this table:
[in this window]
[in a new window]
 
Table 2. Genomic location, primer sequence and annealing temperature of the SSR loci mapped in the F2:4 lines derived from a cross between OAC Seaforth and OAC 95-4 of common bean.

 
Data Analyses and QTL Mapping
Analysis of variance for all traits in each location and a combined analysis across locations were done by means of SAS program (SAS Institute Inc., Cary, NC). A test of error homogeneity in the combined analysis was conducted by Bartlett's {chi}2. The mean values for each trait across the replications and locations were used for the QTL analyses. The goodness-of-fit of the observed segregation ratio for each marker was tested against the expected ratios of 1:2:1 or 3:1. Linkage groups of the markers were determined by the Group command of MAPMAKER/EXP program version 3.0 (Lander et al., 1987) at a LOD score of 3.0 with a maximum distance between two markers of 50 centimorgans (cM). A subset of RFLP markers found from each group was used as a framework. The order within this subset of markers was determined by the Compare command at a LOD score of 3.0. Additional markers were subsequently added by the Try command. The best order of the markers was then verified by the Ripple command with a LOD score of 2.0 or higher. The associations between molecular marker and QTL were analyzed by interval mapping using MAPMAKER/QTL (Lander and Botstein, 1989). A LOD score of 2.5 or higher was used to declare cosegregation of putative QTL and genetic markers. The amount of phenotypic variation simultaneously explained by all QTL found for a given trait was determined by a multiple QTL model.


    RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Marker and Linkage Analysis
One hundred fifteen markers were assigned into 12 linkage groups with a combined linkage distance of 1717 cM (Fig. 1) . The markers that were assigned to the linkage map included 49 AFLPs, 43 RFLPs, 11 SSRs, 9 RAPDs, one sequence characterized amplified region (SCAR), one major gene for resistance to CBB, and one morphological marker (growth habit). The average linkage distance between pairs of markers in all linkage groups was 15 cM. The maximum distance (48.6 cM) separating two markers occurred in linkage group G3, and the minimum distance between two markers was 2.2 cM in linkage group G4.





View larger version (93K):
[in this window]
[in a new window]
 
Fig. 1. QTL plots for the 14 agronomic traits in common bean and the alignment of linkage groups from the current map (linkage groups G1–G12), the previous map that was developed at the University of Florida (linkage groups A–K; Vallejos et al., 1992) and the core map of common bean (B2–B11; Freyre et al., 1998). The maps were drawn on the same scale. No common loci were found between linkage groups G8 or G12 of the current map with linkage groups H and L of the University of Florida map. Vertical bars indicate the location of QTL for a given trait with a LOD value >2.5 in the mean environment (see Table 6). Map units are in centimorgans. Loci that deviated from Mendelian segregation ratio are indicated with *. Y = seed yield; DF = days to flowering; DM = days to maturity; PH = plant height; TN = total nodes; TB = total branches; Ag = branch angle; HD = hypocotyl diameter; Lg = lodging; HI = harvest index; UP = upper pods; PPP = pods per plant; SPP = seeds per pod; SW = 100-seed weight; GH = growth habit.

 

View this table:
[in this window]
[in a new window]
 
Table 6. Genomic locations and phenotypic effects of QTL for 14 quantitative traits responsible for seed yield, yield components, and plant architectural traits in 142 F2:4 lines derived from a cross between OAC Seaforth and OAC 95-4 of common bean detected at two locations.

 
The goodness-of-fit of the observed segregation ratio to the expected ratio for codominant markers indicated that 36 of the RFLP markers and two of the RAPD markers (UBC446-1200 and UBC460-2650) did not deviate significantly from the expected 1:2:1 ratio (P >= 0.10). RFLP markers with distorted segregation ratios were placed on linkage group G1 and G2 (Fig. 1). These markers had a greater frequency of heterozygotes and a smaller frequency of homozygotes either for OAC Seaforth or OAC 95-4 alleles. Seven out of 11 SSR markers fit the 1:2:1 ratio. Thirty-seven of the 49 AFLP markers fit the expected 3:1 ratio (P >= 0.05). The alignment of the current map with that of Vallejos et al. (1992) identified 30 RFLP loci in common positions (Fig. 1).

Field Data Analysis
The means of the parental lines and the F2:4 lines, and the variance components of the F2:4 lines for the Elora, Woodstock, and mean locations are shown in Table 3. For the F2:4 lines, means of most traits, except for days to flowering, days to maturity, branch angle, and upper pods, were higher at Woodstock. Deviations from normality were found for seeds per pod, upper pods, 100-seed weight, and lodging. A logarithmic transformation was applied to these data sets prior to QTL analysis. Genotypic variances for traits in the F2:4 population varied according to the locations and were significant for all the traits that were measured (Table 3). However, the estimates in single locations were biased upwards because there were no estimates of the genotype x environment variance components. Significant genotype x environment interactions were observed for seed yield, plant height, days to flowering, maturity, branch angle, total branch, hypocotyl diameter, pods per plant, upper pods, harvest index, and lodging. No significant genotype x environment interactions were observed for total nodes, seeds per pod, and 100-seed weight.


View this table:
[in this window]
[in a new window]
 
Table 3. Mean values and variance components of the OAC 95-4, OAC Seaforth, and F2:4 lines for the 14 quantitative traits responsible for seed yield, yield components, and plant architectural traits in common bean measured across two locations.

 
The phenotypic correlation analysis showed that seed yield was correlated significantly with days to maturity, plant height, total nodes, branch angle, harvest index, and pods per plant (Table 4). Significant correlations to seed yield were found for harvest index, plant height days to maturity, total nodes, angle, and pods per plant. The correlations between seed yield and days to flowering, total branch, hypocotyl diameter, lodging, upper pods, seeds per pod, and 100-seed weight were not significant. Days to maturity was correlated significantly with days to flowering, plant height, total nodes, angle, hypocotyl diameter, upper pods, and pods per plant. Significant and positive correlations were found among plant height, total nodes, total branch, and hypocotyl diameter, which were considered to be components of upright plant architecture. In contrast, the correlations of other characters and branch angle or upper pods were mostly negative. No significant correlations were observed between seeds per pod and all other traits measured in this study.


View this table:
[in this window]
[in a new window]
 
Table 4. Pearson correlation coefficients among 14 quantitative traits responsible for seed yield, yield components, and plant architectural traits measured on 142 F2:4 lines derived from a cross between OAC Seaforth and OAC 95-4 of common bean across two locations.

 
Growth Habit
Classification of the 142 lines for growth habit identified 40 lines as homozygous determinate, 34 lines as homozygous indeterminate, and 68 lines segregating. A line was considered homozygous for a given growth habit if more than 95% of the individuals had the same type of growth habit. A {chi}2 analysis showed a good fit of the growth habit distribution to a 1:2:1 ratio ({chi}2 = 0.761, 0.50 < P < 0.70) indicating that a single gene determined the trait. On the basis of the result of the segregation analysis, the gene for growth habit (GH) was mapped along with the molecular markers.

QTL Analysis
Significant associations between molecular markers and putative QTL that were measured for the F2:4 population in the study were found for all traits. In total, 20 QTL were detected for the 14 traits that were analyzed (Table 5). The number of QTL identified per trait ranged from one to three. Single QTL (LOD = 2.5) were found for days to flowering, total nodes, total branch, hypocotyl diameter, pods per plant, upper pods, seeds per pod, harvest index, and lodging. Two QTL were identified for days to maturity, plant height, branch angle, and 100-seed weight. Three QTL were found for seed yield. At least one QTL was detected on every linkage group, except on linkage groups G4, G6, and G12. The largest number of QTL (5 QTL) was found on linkage group G11. The multiple QTL model for each trait showed that these genomic regions accounted for 11.3 to 43.1% of the total phenotypic variation of the traits.


View this table:
[in this window]
[in a new window]
 
Table 5. Genomic location, percentage of the phenotypic variation, genetic effects and direction of the QTL detected for 14 traits responsible for seed yield, yield components, and plant architectural traits in 142 F2:4 lines derived from a cross between OAC Seaforth and OAC 95-4 of common bean across two locations.

 
Three genomic regions on linkage groups G5, G9, and G11 were associated with seed yield and collectively these accounted for 27.8% of the phenotypic variation. For the two regions mapped to linkage groups G5 and G11, the alleles from OAC 95-4 contributed to increased seed yield. These QTL (BNG161/DraI and BNG228/HindIII) were acting in an overdominant fashion. The genetic character near the SCARxan-700 marker could not be determined because of the dominance nature of the marker.

The morphological marker (GH), located at the end of linkage group G11 was significantly associated with QTL for days to flowering, days to maturity, and angle. This region explained 24.2, 29.4, and 11.2% of the variation of days to flowering, days to maturity, and angle, respectively. For the first two traits, this region acted in a partial dominance manner and the allele from OAC 95-4 delayed the flowering date and maturity. The genetic locus near the SCARxan-700 marker accounted for 16.8% of the phenotypic variation for days to maturity.

Two QTL were detected for plant height. A genomic region on linkage group G1 at 6.0 cM from BNG42/PstI explained 36.2% of the variation in plant height. It acted in an overdominant fashion and the allele from OAC 95-4 increased plant height. Another genomic region near the UBC446-1200 locus on linkage group G3 explained 8.6% of the phenotypic variation in plant height. The allele from OAC Seaforth increased the height of the plants. Both QTL simultaneously explained 38.8% of the variation in plant height.

A QTL for total nodes was detected near an AFLP marker AAGCAT-520 on linkage group G9. This genomic region explained 28.1% of phenotypic variation for this trait. A QTL on linkage group G2 was identified for total branch and accounted for 13.9% of the phenotypic variation for this trait. The angle of the branches to the main stem is an important component of upright plant architecture. Two QTL were detected that contributed to the angle of the branch and they collectively accounted for 16.6% of the phenotypic variation for this trait. These genomic regions (BNG5/DraI and GH) were located on linkage group G11 and they acted in an overdominant genetic fashion to the angle. The allele from OAC Seaforth increased the angle at both loci.

A genomic region near BNG130/EcoRV on linkage group G2 affected hypocotyl diameter, which is a desirable component of upright plant architecture. The QTL explained 11.3% of the phenotypic variation and acted in an overdominant genetic fashion. The allele from OAC Seaforth increased the diameter of hypocotyl at this locus.

Pods per plant, seeds per pod, and 100-seed weight are considered to be major components of seed yield. However, only pods per plant was significantly correlated with seed yield in this study. One QTL each on linkage group G2 (BNG151/EcoRV) accounted for 18.8% of the phenotypic variation for pods per plant. This locus had an overdominance genetic effect with the allele from OAC 95-4 increasing the number of pods per plant. A QTL on linkage group G5 (AGGCTT-510) explained 28.2% of the variation for seeds per pod. Two QTL, one on linkage group G2 (ACGCTA-350) and another on linkage group G10 (ACACTG-530) accounted for 17.8% of the phenotypic variation for 100-seed weight. A QTL near ACTCAT-490 on linkage group G7 explained 21.4% of the phenotypic variation for harvest index, which was also significantly correlated with seed yield. A genomic region on linkage group G9 (AAGCAT-520) accounted for 15.3% of the variation in pod distribution to the upper two thirds of the plant. A single major QTL on linkage group G8 (AAGCAT-418) was detected that explained 43.1% of the phenotypic variation for lodging.

Consistency of QTL across Locations
The QTL analyses in single environments demonstrated that 11 QTL were detected at Elora and 22 QTL were identified at Woodstock (Table 6). Only 25% (5 of 20) of the QTL that were detected in mean location were also detected at Elora and Woodstock. These included one locus each for plant height, total nodes, upper pods, seeds per pod, and lodging. Fourteen QTL that were not detected in the mean location were identified at either Elora or Woodstock. The strengths of the QTL effects for a given trait appeared to be slightly different from one environment to another, but the positions of the were mostly stable.


    DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The bean population used in this study showed considerable variation for seed yield and yield components, architecture-related traits, flowering, and maturity. Ghaderi and Adams (1981) and Nienhuis and Singh (1985) also reported significant genetic variances for yield and architecture related traits (plant height, the number of nodes, and branches) in bean. Thus, development of a wide array of bean phenotypes with high yield potential, different architectures and maturities appears possible.

Information about the correlations among traits is important for defining bean ideotypes for selection. Positive correlations among the components of bean architecture and yield would be desirable. However, negative relationship known as compensation phenomenon among yield-related traits have often been observed (Adams, 1967), and can hinder progress to improve yield. The current study revealed positive and significant correlations between seed yield and plant height (r = 0.23), total nodes (r = 0.18), harvest index (r = 0.24), and pods per plant (r = 0.18), respectively, whereas, a negative correlation was found between seed yield and branch angle. The correlation values obtained in the current study were comparable to those reported previously for beans. Beattie (1998) demonstrated positive and significant correlations between seed yield and harvest index (r = 0.27), plant height (r = 0.46), pods per plant (r = 0.32), and lodging (r = 0.44). Scully et al. (1991) reported a positive correlation between yield and harvest index (r = 0.27). Nienhuis and Singh (1988) reported a significant correlation between yield and plant height (r = 0.67) and between yield and pods per square meter (r = 0.33).

Several linkage maps have been developed for common bean (Adam-Blondon et al., 1994; Ariyarathne et al., 1999; Bai et al., 1997; Jung et al., 1996; Nodari et al., 1993; Vallejos et al., 1992). The large number of maps reflects the fact that no single population will segregate for all of the agronomic traits in common bean. To benefit fully from the existing maps, some connections among the maps are required. Sharing probes for RFLP analyses or primer sequences for PCR-based markers are a means to connect maps. The current map shares 43 RFLP markers with the previous bean linkage map that was developed by Vallejos et al. (1992). However, there were only 30 RFLP markers that could be aligned to the same linkage groups of the previous map. These markers were distributed among 10 (linkage groups G1, G2, G3, G4, G5, G6, G7, G9, G10, and G11) of the 12 linkage groups identified in current study. There was no RFLP marker located on linkage groups G8 and G12 of the current map. Therefore, no connection was made between the latter linkage groups with the Florida map.

Some rearrangements in the marker order within linkage groups were observed in the current study. Rearrangements among markers were also reported by Freye et al. (1998) and Gepts (1998). Differences in the genetic background between the current mapping population and the previous populations may account for some marker rearrangements. Also, several RFLP loci (for example BNG142/HindIII, BNG130/EcoRV, BNG125/EcoRV, BNG205/DraI, and BNG170/BamHI) that were placed on different groups in the current map were generally located at the tips of the corresponding linkage groups of the Florida map. These locations are known to be difficult to map accurately in small populations or with limited number of markers.

Bean is a diploid and contains 11 pairs of chromosomes (2n = 2x = 22). The current map consists of 12 linkage groups and is approximately 1717 cM in size. The size of the map is larger than the estimated genome size (1200 or 1226 cM) of bean (Vallejos et al., 1992; Freyre et al., 1998). Some regions of the current map do not have dense coverage; for example, linkage groups G2, G3, G8, and G10. These areas accounted for most of the discrepancies with the previous map. The presence of an additional linkage group in the current map suggests that a fragment linking two of the existing groups is missing. These discrepancies may be resolved by future studies with larger population sizes and more markers.

Growth habit is an important trait for common bean. The fin gene controls determinate growth habit in bean (Coyne and Schuster, 1974; Koinange at al., 1996; Park et al., 1999b). Gepts et al. (1993) identified a RFLP marker (D1051) linked to the fin gene. The fin gene maps to linkage group D1 of the University of California Davis map, which corresponds to linkage group H of the Florida map (Freyre et al., 1998). In the current map, the GH locus is located on linkage group G11 or linkage group K of the Florida map. Therefore, our results suggest that a second gene for determinate growth habit exists in bean that is located on a different linkage group than fin.

Evidence for a common genetic basis for some correlated traits was obtained in this study. Phenotypic and genotypic correlations indicate that the genes for the traits are either linked, have pleiotropic effects or are influenced similarly by the environment (Aastveit and Aastveit, 1993). Pleiotropy and/or gene linkage may explain the clustering of QTL observed in several regions of the current map. For example, days to flowering and days to maturity, which were highly correlated (r = 0.64), each had a QTL near the GH locus. The OAC 95-4 parent contributed to delayed flowering and maturity in this region. Therefore, this may be an example of two traits influenced by a common gene. In contrast, the branch angle also had a QTL close to the GH locus. However, this trait was negatively correlated to delayed flowering and maturity. OAC Seaforth contributed the allele that increased branch angle. Therefore, these associations may represent an example of gene linkage. Pleiotropic effects of a gene that condition different traits have previously been reported in common bean. For example, Koinange at al. (1996) reported pleiotropic effects of fin on the number of days to flowering and maturity, number of nodes on the main stem and number of pods. An earlier study by Miklas et al. (1996) demonstrated that a common genetic factor was responsible for resistance to CBB in leaves and pods of common bean. Ariyarathne et al. (1999) found that QTL for pod resistance to CBB, leaf resistance to halo blight [caused by Pseudomonas syringae pv. phaseolicola (Burkholder 1926) Young, Dye & Wilkie 1978] and the I gene (that confers resistance to bean common mosaic virus) were linked.

The cumulative strength of the QTL effects, expressed as the total phenotypic variation explained, ranged from 11% for hypocotyl diameter to 43% for lodging. In other studies of common bean, comparable amounts (14–34%) of phenotypic variation for resistance to CBB, foliar resistance to web blight [caused by Thanatephorus cucumeris (A.B. Frank) Donk (anamorph—Rhizoctonia solani Kühn)] and resistance to rust [caused by Uromyces appendiculatus (Pers.: Pers.) Unger] were reported by Jung et al. (1996). As high as 16% of the variability for plant uprightness was captured by a single marker in the same study (Jung et al., 1996). Park et al. (2000) identified five QTL that explained simultaneously 44% of the phenotypic variation for seed weight in a recombinant inbred population derived from a cross between PC-50 and XAN 159. Heritability estimates from previous studies showed that between 0.32 and 0.34 of the phenotypic variation for seed yield of common bean was genetic in origin (Davis and Evans, 1977; Singh et al., 1999). For seed weight, the heritability estimates ranged from 0.24 to 0.65 (Kornegay et al., 1992; Singh et al., 1999). Higher heritability estimates (0.77–0.96) were reported for days to maturity (Davis and Evans, 1977; Singh et al., 1999). In the current study, the amount of phenotypic variation explained by the QTL for seed yield, 100-seed weight, and days to maturity were 27.8, 17.8, and 42.4%, respectively. The discrepancies between previous heritability estimates and the proportion of phenotypic variation explained by the detected QTL for various traits in the current study indicate that additional QTL for these traits exist, perhaps with small and/or nonadditive effects. The large genetic distance (>20 cM) in some regions of the current linkage map and the intermediate size of the population that was used in the current study may have prevented the detection of QTL with small effects.

The majority of the QTL in the current population were identifiable in the mean location, therefore, the QTL that were detected were considered to be representative of the population. Alleles from OAC 95-4 increased trait values at 6 of the 10 QTL. For seed yield, days to flowering, days to maturity, and pods per plant, only OAC 95-4 increased the values of the traits. In contrast, OAC Seaforth contributed alleles for increasing the branch angle and hypocotyl diameter. Both parents contributed alleles for increasing plant height.

The relatively high level of overdominance that was detected at the QTL in the present study may be attributable to a pseudo-overdominance effect (Moll et al., 1964). These QTL may be in regions of the genome containing several loci that contribute to the overall effect. In particular, loci in repulsion linkage (which are at their maximum in F2-derived lines) could account for some of the overdominance effects. The additive effect of such genes in repulsion linkage would partly cancel each other, which would allow the overall dominance effect to seem larger than the underestimated additive effect and result in an overdominance effect at the locus. A large proportion of overdominance gene effects of the QTL for grain yield and yield components, plant height, and flowering in corn (Zea mays L.) was reported by Veldboom and Lee (1996a)( b).

In the present study, only five of the 20 QTL that were detected in the mean location were detected in both locations. In particular, none of the three QTL for seed yield that were detected by the mean location data was detected in both locations. Park et al. (2000) reported that only two out of seven QTL for seed size of common bean were expressed in two environments. It is not known if the restriction of QTL to only one environment is related to gene expression or is indicative of sampling variation (Beavis, 1994). The inconsistency of QTL over environments may be a major limitation in utilizing QTL for marker-assisted selection (MAS) of genotypes for the environments that differ from the environment in which the QTL were detected.

There is accumulating evidence that associations between molecular markers and QTL controlling traits in bean are maintained across different populations. For example, Tar'an et al. (1998) demonstrated that the association between molecular markers and resistance to CBB remained stable across different bean populations. Furthermore, Jung et al. (1999) reported that a QTL for CBB resistance was significantly associated with the trait at least in three bean populations for three X. campestris pv. phaseoli strains. Of six QTL affecting leaf and pod resistance to CBB (Jung et al., 1997), at least three were confirmed in a different bean population (Park et al., 1999a). Therefore, the 20 QTL identified in the present study for seed yield, yield components, and plant architecture with medium to large effects may be valuable for use in MAS. Furthermore, the QTL were placed on a map that is connected to the University of Florida and the core linkage maps for P. vulgaris. This should allow bean geneticists and breeders to benefit fully from the current information.


    ACKNOWLEDGMENTS
 
The work was supported by the Ontario Ministry for Agriculture, Food and Rural Affairs, the White Bean Marketing Board, and the Natural Sciences and Engineering Research Council of Canada. Thanks to Tom Smith, Lori Herteis, and Aaron Beattie for help with the field work.

Received for publication January 26, 2001.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 




This article has been cited by other articles:


Home page
Crop Sci.Home page
M. W. Blair, T. A. Sandoval, G. V. Caldas, S. E. Beebe, and M. I. Paez
Quantitative Trait Locus Analysis of Seed Phosphorus and Seed Phytate Content in a Recombinant Inbred Line Population of Common Bean
Crop Sci., January 28, 2009; 49(1): 237 - 246.
[Abstract] [Full Text] [PDF]


Home page
Crop Sci.Home page
A. Tullu, B. Tar'an, T. Warkentin, and A. Vandenberg
Construction of an Intraspecific Linkage Map and QTL Analysis for Earliness and Plant Height in Lentil
Crop Sci., November 24, 2008; 48(6): 2254 - 2264.
[Abstract] [Full Text] [PDF]


Home page
J HeredHome page
M. Kwak, D. Velasco, and P. Gepts
Mapping Homologous Sequences for Determinacy and Photoperiod Sensitivity in Common Bean (Phaseolus vulgaris)
J. Hered., May 1, 2008; 99(3): 283 - 291.
[Abstract] [Full Text] [PDF]


Home page
Crop Sci.Home page
J. J. Maxwell, M. A. Brick, P. F. Byrne, H. F. Schwartz, X. Shan, J. B. Ogg, and R. A. Hensen
Quantitative Trait Loci Linked to White Mold Resistance in Common Bean
Crop Sci., November 7, 2007; 47(6): 2285 - 2294.
[Abstract] [Full Text] [PDF]


Home page
Crop Sci.Home page
J. R. Gelin, S. Forster, K. F. Grafton, P. E. McClean, and G. A. Rojas-Cifuentes
Analysis of Seed Zinc and Other Minerals in a Recombinant Inbred Population of Navy Bean (Phaseolus vulgaris L.)
Crop Sci., July 30, 2007; 47(4): 1361 - 1366.
[Abstract] [Full Text] [PDF]


Home page
Crop Sci.Home page
G. M. Timmerman-Vaughan, A. Mills, C. Whitfield, T. Frew, R. Butler, S. Murray, M. Lakeman, J. McCallum, A. Russell, and D. Wilson
Linkage Mapping of QTL for Seed Yield, Yield Components, and Developmental Traits in Pea
Crop Sci., May 27, 2005; 45(4): 1336 - 1344.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
H. Wang, Y.-M. Zhang, X. Li, G. L. Masinde, S. Mohan, D. J. Baylink, and S. Xu
Bayesian Shrinkage Estimation of Quantitative Trait Loci Parameters
Genetics, May 1, 2005; 170(1): 465 - 480.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
Y.-M. Zhang, Y. Mao, C. Xie, H. Smith, L. Luo, and S. Xu
Mapping Quantitative Trait Loci Using Naturally Occurring Genetic Variance Among Commercial Inbred Lines of Maize (Zea mays L.)
Genetics, April 1, 2005; 169(4): 2267 - 2275.
[Abstract] [Full Text] [PDF]


Home page
Crop Sci.Home page
J. M. Kolkman and J. D. Kelly
QTL Conferring Resistance and Avoidance to White Mold in Common Bean
Crop Sci., March 1, 2003; 43(2): 539 - 548.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (17)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tar'an, B.
Right arrow Articles by Pauls, K. P.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Tar'an, B.
Right arrow Articles by Pauls, K. P.
Agricola
Right arrow Articles by Tar'an, B.
Right arrow Articles by Pauls, K. P.
Related Collections
Right arrow Other Legumes
Right arrow Crop Genetics


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
The SCI Journals Agronomy Journal Vadose Zone Journal
Journal of Natural Resources
and Life Sciences Education
Soil Science Society of America Journal
Journal of Plant Registrations Journal of
Environmental Quality
The Plant Genome