Crop Science 41:846-853 (2001)
© 2001 Crop Science Society of America
CELL BIOLOGY & MOLECULAR GENETICS
Partial Resistance of Transgenic Peas to Alfalfa Mosaic Virus under Greenhouse and Field Conditions
Gail M. Timmerman-Vaughan*a,
Meeghan D. Pither-Joycea,
Pauline A. Coopera,
Adrian C. Russellb,
David S. Gouldena,
Ruth Butlera and
Jan E. Granta
a New Zealand Institute for Crop & Food Research Ltd, PO Box 4704, Christchurch, New Zealand
b New Zealand Plant Breeding Ltd, PO Box 19, Lincoln, New Zealand
* Corresponding author (timmermang{at}crop.cri.nz)
 |
ABSTRACT
|
|---|
Transformed pea (Pisum sativum L.) lines were produced with two chimeric gene constructs encoding the coat protein (CP) of alfalfa mosaic virus (AMV) strain NZ1. To determine whether transformed lines have improved AMV resistance, progeny of independently derived transgenic lines were tested in the greenhouse and five lines with improved virus resistance were identified. Resistance was observed only in individual plants that accumulated detectable CP product from the transgene, suggesting that resistance is CP mediated. Plants that accumulated detectable amounts of transgene CP product yet were susceptible to AMV were found among the progeny of most lines, indicating that these lines are only partially resistant to the challenging AMV strains, 425 and NZ1(Lincoln). A field test was conducted with the progeny of four independently derived transgenic lines. To test for improved virus resistance under field conditions, plots of transgenic lines and nontransgenic controls were inoculated with two AMV strains, NZ1(Lincoln) and NZ34. Analysis of disease severity in seedlings in inoculated plots confirmed that partial virus resistance can be produced by genetically modifying peas with AMV CP sequences.
Abbreviations: AMV, alfalfa mosaic virus CP, coat protein PCR, polymerase chain reaction RT, reverse transcription T0, T1, T2 and T3, independently-derived transgenic lines and first, second and third generation inbred progeny, respectively T-DNA, transfer DNA TMV, tobacco mosaic virus
 |
INTRODUCTION
|
|---|
ALFALFA MOSAIC VIRUS affects a range of host plants (Jaspars and Bos, 1980), including pea. Symptoms of AMV infection in pea include stem necrosis, veinal necrosis, plant stunting, reduced seed size, and reduced yield. AMV is nonpersistently aphid transmissible. Perennial legumes [eg., white clover (Trifolium repens and alfalfa (Medicago sativa L.)] are common sources of virus infection. In New Zealand, field infection of peas increased in importance after the introduction of the pea aphid, Acyrthosiphon pisum (Harris), in the 1970s (Fletcher, 1993).
Genetic modification of plants with plant viral CP genes is an example of pathogen-derived resistance that has been used successfully to produce viral disease resistance (reviewed in Lomonossoff, 1995; Beachey, 1997). Two examples of pathogen-derived resistance have been described in transgenic pea, CP-mediated resistance to pea enation mosaic virus (Chowrira et al., 1998) and replicase-mediated resistance to pea seed-borne mosaic virus (Jones et al., 1998). Transformation of peas to produce agriculturally important insect resistance traits has also been reported (Chrispeels et al., 1998; Charity et al., 1999; Morton et al., 2000).
No effective host-derived resistance to AMV is known in pea, therefore pathogen-derived resistance provides an approach to developing AMV resistance. To produce resistance to AMV in other plant species, the AMV CP gene has been introduced into tobacco (Nicotiana tabacum L.) (Tumer et al., 1987; Van Dun et al., 1987; Anderson et al., 1989; and Xu et al., 1998), tomato (Lycopersicon esculentum Mill.) (Tumer et al., 1987) and alfalfa (Hill et al., 1991). Resistance to AMV has been observed in tobacco (Loesch-Fries et al., 1987; Tumer et al., 1987; Loesch-Fries, 1990) and in alfalfa protoplasts (Hill et al., 1991) that accumulated comparatively large amounts of AMV CP.
To produce improved resistance to AMV, pea were transformed with two versions of a translatable chimeric AMV CP gene. In this paper, we describe the development and characterization of the transgenic plants, and report the results from greenhouse and field trials to examine efficacy of the approach for producing AMV resistance.
 |
MATERIALS AND METHODS
|
|---|
Construction of Binary Vectors Containing AMV CP Sequences
The CP coding region of AMV NZ1 (Genbank accession AMU12509) was amplified from plasmid DNA provided by Richard Forster (Hort+Research, Auckland, New Zealand) by means of the upstream primer AMVCP1 (GCCTCTAGAACCATGAGTTCTTCACAA) and the downstream primer AMVCP2 (TCAATGACGATCAAGATA). AMV CP sequences or sequence complements are underlined. The 5' tail on primer AMVCP1 contains an XbaI restriction endonuclease site for directional cloning in the binary vector. Polymerase chain reaction (PCR) amplifications (50 µL) contained 1.6 units of Taq DNA polymerase (Roche Bioscience, Palo Alto, CA), 1x amplification buffer as supplied by the manufacturer, dNTPs to 200 µM each, and 1 µM each primer. Reactions were incubated for 30 cycles of 94°C for 1 min, 45°C for 1 min, and 72°C for 1 min. The amplified fragment was digested with XbaI in preparation for cloning then extracted with phenol/chloroform. Unincorporated primers, dNTPs and the small XbaI fragment were removed by dialysis with a Millipore Ultrafree-MC 30 000 NMWL filter unit (Millipore Corp., Bedford, MA). Two binary vectors, pGA643 (An et al., 1988) and pTMV35S (Liew, 1994), were prepared for cloning by digestion with HpaI and XbaI, followed by dephosphorylation with calf intestinal alkaline phosphatase. Vector pAMV75 contains the AMV NZ1 CP coding region inserted in the pGA643 polylinker downstream from the CaMV 35S promoter. Vector p
AMV5 was produced by ligating the AMV NZ1 CP coding region in the polylinker sequence of plasmid pTMV35S, downstream from the CaMV 35S promoter and TMV
' translation enhancer (Gallie et al., 1987). Both plasmids also contain a chimeric nos-nptII-nos gene within the transfer DNA (T-DNA), which provides kanamycin resistance for use in selecting transformed plant cells. The sequences of the chimeric AMV CP genes and adjacent regulatory regions were confirmed by DNA sequencing.
Plant Transformation
Field-grown pea were used for transformation. The varieties used were the process pea breeding line 94-A26 [Crop & Food Research, Lincoln, New Zealand (C&FR)]; the maple pea Crown (C&FR); and the semi-leafless blue pea breeding line 89T46.UK13 (C&FR), designated A26, Crown and K13, respectively. Transformation of immature pea cotyledons was as described in Grant et al. (1998) using kanamycin as the selection agent and binary vectors pAMV75 and p
AMV5. Table 1 summarizes the genetic backgrounds of the lines described in this paper.
View this table:
[in this window]
[in a new window]
|
Table 1. Summary information for the independently derived transgenic lines described in this report, including parental varieties and binary vectors used for transformation, designations used to label T0 lines and progeny, and progeny pedigrees.
|
|
Molecular Analysis of Transgenic Plants
Total DNA was isolated from transgenic lines, and Southern hybridization was conducted to analyze T-DNA integration and copy number, as described by Timmerman et al. (1993). Blots were prepared from total pea DNA digested with restriction endonuclease HindIII. Southern blots were hybridized with AMV NZ1 CP sequences amplified from the binary vector p
AMV5 with the CP cloning primers described above. PCR fragments for use as probe DNA were purified with the High Pure PCR Product Purification kit (Roche).
Western blots were used to analyze the expression of AMV CP from the chimeric transgene, as described by Timmerman et al. (1993), with the following modifications. Leaf samples were homogenized in 2x sample buffer at a ratio of 1:6 (w/v). Samples of 12 µL were loaded onto the 10% (w/v) sodium dodecyl sulfate acrylamide gel. AMV CP standards were produced by diluting leaf tissue homogenate from infected plants showing vein clearing symptoms 1:12 with leaf tissue homogenate from uninfected plants. Proteins were transferred onto supported nitrocellulose membranes (Hybond-C Super, Amersham Pharmacia Biotech, Inc., Piscataway, NJ) by semi-dry transfer (Bio-Rad, Richmond, CA) following the manufacturer's instructions. Blots were developed using polyclonal anti-AMV sera kindly provided by R. Larsen (USDA-ARS, Prosser, WA, USA) and alkaline phosphatase-conjugated goat anti-rabbit sera (Bio-Rad).
Plant Virus Resistance Tests
AMV strains NZ1(Lincoln) and 425 were provided by R. Forster (Hort+Research, Auckland, NZ), and AMV strain NZ34 was provided by J. Fletcher (Crop & Food Research, Lincoln, NZ). The viral strain used for greenhouse and field test inoculation was renamed NZ1(Lincoln) since its CP sequence differs from the NZ1 sequence used for binary vector construction (see Results). Viruses were initially inoculated onto Chenopodium quinoa Willd. or Gomphrena globosa L. Local lesions were then reinoculated onto C. quinoa or G. globosa and infected leaves were stored at -80°C. Before inoculum for virus challenge experiments was needed, Crown pea were inoculated by means of frozen infected leaves diluted 1:4 (w/v) with 50 mM sodium phosphate buffer, pH 7.2. Inoculum for greenhouse and field tests was prepared by grinding leaves from pea plants showing veinal necrosis at a dilution of 1:7 (w/v). Leaves of greenhouse plants to be inoculated were dusted with carborundum powder prior to inoculation. Sap for field inoculation was prepared in sodium phosphate buffer containing carborundum powder. Plants were rub-inoculated on two compound leaves at approximately the six leaf stage. Semileafless peas were rub-inoculated on two pairs of stipules. After inoculation, tissues were rinsed with deionized water. Greenhouse plants were inoculated twice, 7 d apart, while field test plants were inoculated once.
T1 and T2 descendants of transgenic lines were tested for AMV resistance in four greenhouse challenge experiments. AMV disease development in inoculated plants was monitored by immunodot assays. Systemically infected leaves were sampled by pinching out semicircular leaf disks with the lid and rim of 1.5-mL microfuge tubes. Four compound leaves (or stipules for semi-leafless peas) were sampled above the inoculated leaves/stipules and on the same stem. Crude extracts were prepared by grinding the leaf disks in 300 µL of extraction buffer [35 mM K PO4, pH 7.5, 400 mM NaCl, 10 mM ß-mercaptoethanol and 0.1% (v/v) Triton X-100]. Particulate material was pelleted in a microfuge at 15 800 g for 2 min. One microliter of the resulting supernatant was diluted in approximately 300 µL of Tris-buffered saline (TBS; 50 mM Tris-HCl, pH 7.5, 200 mM NaCl) and then transferred with the application of vacuum onto a nitrocellulose membrane (Hybond C-Super, Amersham) with a dot-blot apparatus (Bio-Rad). The wells were washed once with approximately 500 µL TBS. Immunodots were developed in the same way as western blots, described above.
In the field trial, AMV disease development was scored visually by the following ordinal score: 0, asymptomatic; 1, faint vein clearing; 2, tops stunted and yellowing; 3, veinal necrosis; and 4, entire plant yellowing.
The CP nucleotide sequences of the AMV NZ1(Lincoln) and NZ34 isolates used to inoculate the field trial were determined. Primers were designed from conserved regions of AMV CP nucleotide sequences in the GenBank database: AMVCP-5' (TCCATCATGAGTTCTTCACA) upstream of the coding region and AMVCP-3' (TCATACCTTGACCTTAATCCA) downstream of the coding region. Total RNA was isolated from inoculum plant leaves stored frozen at -80°C in Trizol reagent (GibcoBRL) according to the manufacturer's instructions. First strand cDNA was generated by means of the downstream primer AMVCP-3' and SuperScript II RNaseH- Reverse Transcriptase (GibcoBRL). Reverse transcription (RT) reactions (40 µL) were performed at 42°C for 45 min in the presence of 2 µg total RNA, 1x first strand buffer as supplied by the manufacturer, dNTPs to 1 mM each, 2 µM primer, 1 mM dithiothreitol, 40 units of RNasin (Promega Corp., Madison, WI), and 200 units of SuperScript II. After heat inactivation of the reverse transcriptase at 95°C for 5 min, PCR was performed. PCR reactions (100 µL) contained 20 µL of the RT reaction, 2.5 units of Taq DNA polymerase (Roche), 0.8x PCR buffer as supplied by the manufacturer, and 1 µM of each primer. Reactions were incubated for 40 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 45 s. PCR products were purified with the High Pure PCR Product Purification Kit (Roche), and then cloned with the pGEM-T Vector System (Promega). Plasmid DNA was isolated with the High Pure Plasmid Isolation Kit (Roche) from colonies that had the insert as determined by PCR with AMVCP-5' and AMVCP-3'. Sequencing reactions were performed with the ABI PRISM Big Dye Terminator Cycle Sequencing Kit (Perkin Elmer, Norwalk, CT) and analyzed on an ABI377 automated sequencer.
Field Trial
The field trial was approved and conducted in accordance with New Zealand Government legislation and regulations. Over the summer of 1998-1999, the field trial was carried out at the Crop & Food Research experimental field station near Lincoln, NZ. In the spring of 1998 (1920 October), the trial was planted in three blocks, one for each treatment: Block 1, to evaluate the performance of uninoculated plants; Block 2, plants mechanically inoculated with AMV NZ1(Lincoln); and Block 3, plants mechanically inoculated with AMV NZ34. Each treatment was conducted in separate blocks to prevent cross-infection by the two strains of AMV. Each block contained 12 plots of 11 randomly arranged transgenic lines (one line was replicated) and two plots each of the non-transgenic control lines. The 18 plots in a block were arranged in six twin rows, with three plots in each twin row. Each plot was hand sown in a twin row, with seeds sown 10 cm apart, and the twin rows spaced 0.3 m apart. Most plots were sown with 40 seeds except transgenic lines A1 and A2, which were sown at the same planting density with 30 seeds per plot, because of limited availability of seed. Plots within a row were separated by a 0.3-m space, and twin rows were 1 m apart. The entire trial was surrounded by two buffer rows of Primo, and two buffer rows were planted between adjacent blocks. Thirty days after sowing, plant emergence was counted for every plot in the experimental blocks. Standard agronomic practices were used: fertilization and irrigation, pre- and post-emergence herbicides, fungicide application, and hand weeding as needed. Dimethoate {phosphorodithioic acid O,O-dimethyl S-[2-methylamino)-2-oxoethyl] ester} systemic insecticide was applied on four dates to control aphids. From the first appearance of flowers, the trial was covered with a bird net.
 |
RESULTS
|
|---|
Molecular Characterization of Transformed Lines
The five transformed lines described in this report, progeny line designations, and pedigrees are shown in Table 1. T0 line C contained T-DNA from pAMV75, the chimeric transgene which lacks the TMV
sequence. The remaining lines contained T-DNA from p
AMV5, the chimeric AMV transgene containing the TMV
translation enhancer sequence.
The AMV CP protein product translated from the chimeric transgene was shown to accumulate in plants from all five of the transgenic lines being described. On the western blots, the AMV CP transgene protein product from both binary vectors pAMV75 and p
AMV5 had the same electrophoretic mobility as AMV 425 CP from infected plant tissue. Figure 1 shows a western blot containing protein extracts of T1 progeny of transgenic line A as an example of the results obtained.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 1. Western blot showing AMV CP transgene expression from T1 progeny of transgenic line A. Lane 1, AMV CP band from AMV 425-infected Chenopodium quinoa; Lane 2, Rainbow Markers (Amersham, not visible on developed western blot); Lane 3, uninfected pea line A26; Lanes 415, transgenic T1 progeny.
|
|
The relationship between transgene segregation and CP accumulation was examined for the five T1 progenies. Transgene segregation was analyzed by Southern blots. T0 plants A, K, and M contained single T-DNA inserts, and expression of transgene CP was detected in all the transgenic T1 descendants examined (data not presented). T0 plants C and L contained seven and two copies of the CP transgene, respectively. The T1 progeny of C and L included transgenic lines that did not accumulate detectable transgene CP. Southern blots showing the transgene segregation patterns for T1 progeny of these two multicopy lines, compared with CP transgene expression, are presented in Fig. 2. No obvious correlation was observed between transgene banding pattern and transgene protein accumulation. For the T1 progeny of C and L the banding patterns of the non-expressing lines were similar to the banding patterns of lines that accumulated CP (Fig. 2). The molecular mechanism of transgene silencing observed in the non-expressing transgenic T1 lines was not examined.

View larger version (60K):
[in this window]
[in a new window]
|
Fig. 2. Southern blot analysis of T-DNA inserts in transgenic pea lines L (A) and C (B) and 12 T1 progeny. Lanes labeled C contain DNA from untransformed parental control plants. All lanes contain HindIII digested total pea DNA. The results of western blot analysis of detectable transgene expression are also presented (n/d, not determined).
|
|
Resistance to AMV in Greenhouse Tests
T1 descendants of the five transgenic lines showed partial resistance to mechanical inoculation with AMV 425 (Table 2). In the greenhouse experiments, susceptibility was determined by examining plants for the appearance of stem or veinal necrosis symptoms and was confirmed using immunodot assays. Plants were scored as susceptible when dots were an obvious purple color after development or as resistant when dots were pale after development and resembled the uninoculated controls from both transgenic and non-transgenic plants. Our immunodot assay detects the amount of CP that accumulates during viral infection, but does not detect the background levels of CP expressed in the transgenic plants.
View this table:
[in this window]
[in a new window]
|
Table 2. Analysis of transgenic T1 progeny of five T0 lines for AMV 425 resistance phenotypes in greenhouse tests and comparison with AMV CP transgene product accumulation detected on western blots.
|
|
T2 descendants of individual resistant T1 plants were tested for resistance to AMV 425 and AMV NZ1(Lincoln) in two additional greenhouse experiments. T2 descendants of C1, K3 x Crown, L1 and L2 showed complete resistance to AMV 425 (data not presented), while C2 showed partial resistance (1/6 plants became infected). The non-transgenic controls for this experiment were Crown (4/4 plants infected) and K13 (3/4 plants infected). Four T2 progenies derived from two transgenic lines were tested for resistance to AMV NZ1(Lincoln) in another experiment. In this experiment, T2 progeny of C2, K1 and K2 showed partial resistance to AMV NZ1(Lincoln) while C1 appeared fully susceptible (data not presented). In this experiment, all non-transgenic Crown (n = 8) and K13 (n = 6) control plants became infected.
AMV Resistance in T1 Lines That Accumulate CP Transgene Product
An association between transgene CP accumulation (detected on western blots) and resistance to AMV 425 in the five T1 progenies was observed (Table 2). Resistance was observed in transgenic lines that accumulated detectable CP (phenotypic class R/+), and no plants were found in the phenotypic class R/- (resistant but with no detectable transgene CP). This comparison suggests that chimeric CP product accumulation is required for the resistance phenotype to be observed. The existence of susceptible transgenic plants indicates that the presence of the transgene alone is not sufficient to confer resistance. Since susceptibility to AMV 425 was observed in lines with detectable (S/+) CP expression, the resistance conferred by transgene CP accumulation is best characterized as partial resistance to viral strains AMV 425 and AMV NZ1(Lincoln).
Field Test of Resistance to Mechanical Inoculation with AMV Strains NZ1(Lincoln) and NZ34
Twelve families of transgenic progeny were tested for AMV resistance in a field trial conducted during the New Zealand 1998-1999 summer. The plants examined descended from individual T1 plants that showed resistance to AMV 425 in greenhouse tests.
The median values for the disease severity scores, and percentage of plants that were asymptomatic are presented in Table 3. In the field, partial resistance to AMV NZ1(Lincoln) is indicated for lines M2, M3, and K3 x Crown. Partial resistance to AMV NZ34 is also suggested, particularly for lines M1, M2, M3, K3 x Crown, A1 (BC), and A2.
View this table:
[in this window]
[in a new window]
|
Table 3. Resistance of transgenic peas to mechanical inoculation with two AMV strains under field conditions. Disease severity scores and percent of asymptomatic plants are compared in inoculated seedlings of non-transgenic controls and transgenic lines, scored on individual plants 18 (NZ1(Lincoln)) and 22 (NZ34) days after inoculation.
|
|
Medians and percent asymptomatic plants are presented because they best represent the structure of the data, which are based on an ordinal scoring system. Two plots of each non-transgenic control (K13, A26, and Crown) were sown for each inoculation treatment. A range of scores was observed for the non-transgenic control plants, and individual plants that displayed no disease symptoms after mechanical inoculation were observed in three K13 plots and one A26 plot (Table 3). These plants are presumed to be inoculation "escapes." In particular, 50% of the K13 plants inoculated with AMV NZ1(Lincoln) in one plot displayed no symptoms. Otherwise, each of the three other control plots containing escapes had a single asymptomatic plant.
Some of the susceptibility to AMV observed in individual transgenic plants in the field may be due to the presence of non-transgenic or non-expressing segregants. Since the previous analysis of these transgenic lines indicated that transgene CP accumulation is required for resistance, western blot analysis was conducted on randomly selected plants to determine which lines were segregating for transgene CP expression (data not presented). The partially resistant lines M1, M2, M3, and A1(BC) showed segregation of transgene CP accumulation, as did susceptible lines C2 and C3.
At flowering, it was obvious that inoculations with each of the AMV strains had a large effect on the size and vigor of the non-transgenic control lines. Figure 3 shows portions of the uninoculated and AMV NZ34 inoculated blocks. In the uninoculated block (Fig. 3 panel A), all plants were large and the transgenic lines were visually indistinguishable from the non-transgenic control lines, except for line M3 x RR17 which was segregating for afilla (af), and K3 x Crown which was segregating for af and purple flowers (a). In Blocks 2 and 3, which were inoculated with NZ1(Lincoln) and NZ34, respectively, the non-transgenic control lines were stunted or severely stunted, and appeared more severely affected by virus inoculation than the transgenic lines. The relative effect of virus inoculation on non-transgenic parental versus transgenic lines in the NZ34 inoculated block is shown in Panels B and C (Fig. 3). Panel B compares the stunting observed in non-transgenic K13 with the vigor of transgenic line M2. M2 displayed partial resistance when scored in the field after mechanical inoculation (Table 3). Panel C shows that the non-transgenic Crown plants were stunted in comparison with plants from transgenic line C2. C2 showed susceptibility to NZ34 when plants were scored for symptoms after inoculation (Table 3). Like C2, most of the inoculated susceptible transgenic lines showed better plant vigor at flowering than the relevant inoculated non-transgenic control (data not presented).

View larger version (152K):
[in this window]
[in a new window]
|
Fig. 3. Appearance of non-transgenic and transgenic lines from the uninoculated (Panel A) and NZ34 inoculated blocks (Panels B and C) under field conditions at the time of flowering. The plots shown in Panel A are (1) K13, non-transgenic parental line, (2) C3, transgenic line, (3) M1, transgenic line and (4) Crown, non-transgenic parental line. In Panel B the plots are (1) K13, non-transgenic parental line, and (2) M1, transgenic line. In Panel C the plots are (1) C2, transgenic line and (2) Crown, non-transgenic parental line.
|
|
Comparison of AMV CP Sequences
The CP nucleotide sequences of the AMV viral strains used as inocula in the field trial experiment, NZ1(Lincoln) and NZ34, were determined (Genbank Accessions AF215663 and AF215664, respectively). Alignments of their inferred amino acid sequences with the NZ1 CP sequence engineered in the pAMV75 and p
AMV5 binary vectors are presented in Fig. 4. Figure 4 also includes the inferred amino acid sequence of AMV 425 (Leiden strain, MAARNA4). The sequence of the AMV 425 used in inocula was not determined directly. The four inferred AMV amino acid sequences varied in only 11 positions across the entire CP sequence. The NZ1(Lincoln) and NZ34 sequences varied from the NZ1 sequence in four and five amino acid residues, respectively. The nucleotide sequences of NZ1 versus NZ1(Lincoln) and NZ34 differed by 9 and 13 nucleotides, respectively (data not presented).

View larger version (64K):
[in this window]
[in a new window]
|
Fig. 4. Alignment of inferred AMV CP sequences. NZ1, AMV NZ1 CP sequence used in binary vector construction (GenBank Accession AMU12509); NZ1(Lincoln), inoculum virus; NZ34, inoculum virus; and AMV 425, GenBank Accession MAARNA4. Amino acids which differ between the sequences are highlighted in bold. The residues that differ from sequence NZ1 are underlined.
|
|
AMV NZ1, the virus with the same CP sequence as the transgene, was not available when the virus challenge experiments were underway. Consequently, the extent of resistance conditioned by the AMV NZ1 CP transgene to challenge with virus with an identical CP sequence could not be determined.
 |
DISCUSSION
|
|---|
Evidence is presented from greenhouse and field experiments that transgenic pea plants expressing a chimeric AMV NZ1 CP gene have improved resistance to AMV. Molecular characterization of resistant and susceptible plants suggests that resistance is CP mediated since resistance was only observed in plants that accumulated CP, as detected on western blots. The possibility that resistance may be RNA mediated cannot be ruled out, however, since transgene expression at the RNA level was not characterized. Previous research has suggested that the resistance observed in transgenic plants modified with AMV CP sequences is CP mediated (Loesch-Fries et al., 1987; Van Dun et al., 1988). Loesch-Fries et al. (1987) found that non-expressing plants or plants that expressed relatively low amounts of CP were susceptible to AMV infection. Van Dun et al. (1988) provided stronger evidence when they showed that transgenic tobacco plants expressing an AMV CP gene containing a frameshift mutation were susceptible to AMV inoculation, while plants expressing the wild-type CP were resistant.
The inference that resistance is CP mediated has ramifications for applying the technology. To develop transgenic lines with AMV resistance for incorporation in a pea breeding program, an effective method for screening transgenic lines will be required. A screening regime that first identifies lines that accumulate large amounts of CP using western blots might be most effective. Our analysis of T1 progeny of five transgenic lines with varying T-DNA copy number showed that AMV CP transgene silencing occurs. Silencing was observed as a failure of detectable transgene CP to accumulate in transgenic progeny of two T0 lines, both containing multiple T-DNA copies. Transgene silencing can be associated with both multiple T-DNA copies and high level transgene expression (reviewed in Matzke and Matzke, 1995; Meyer, 1995; Stam et al., 1997). To avoid the effect of multiple T-DNA copies, it may be most efficient to identify the lines with single copy T-DNA inserts from among the high expressors as the second step in the screening process. In our experiments using a limited number of lines, segregation analysis showed that the CP accumulation phenotype was stably expressed in progeny of single copy T0 lines, but not of multicopy lines. Our results showed that copy number cannot be inferred by analyzing segregation of the CP accumulation phenotype in T1 progeny of uncharacterized T0 lines. Therefore, a suggested protocol for incorporating the technology in a breeding program would be to produce T0 lines, screen for CP accumulation with western blots, then screen high expressors to select single copy lines by Southern blots.
Greenhouse studies identified five independently derived transgenic pea T0 lines whose progeny showed AMV resistance, and the descendants of four of these lines were field tested. In both the greenhouse and the field, some inoculated transgenic plants developed an AMV infection. Therefore, the resistance observed is best characterized as partial resistance. The greenhouse and field tests involved inoculations using three strains, 425, NZ1(Lincoln) and NZ34, all having different CP sequences than the transgene. The resistance conferred to transgenic pea by the AMV NZ1 CP transgene is not strictly strain specific since partial resistance is observed to these three different viral strains.
Previous studies (Loesch-Fries et al., 1987; Van Dun et al., 1988; Xu et al., 1998) examined strain specificity of AMV resistance in transgenic tobacco. These studies involved transgenic tobacco modified with the AMV 425 CP sequence. Van Dun et al. (1988) showed that an AMV 425 CP expressing line was resistant to YSMV, the necrotizing strain of AMV. Loesch-Fries et al. (1987) showed that transgenic AMV 425 CP lines were resistant to a related viral strain (AMV McKinney) but not to an unrelated virus (TMV). Xu et al. (1998) challenged AMV 425 CP expressing tobacco lines with two related AMV strains, AMV-KY and AMV-NC. The transgenic lines showed greatest resistance to AMV 425 (7 of 11 lines completely resistant), followed by AMV-KY (2 of 11 lines completely resistant), and AMV-NC (no lines completely resistant). These experiments and our results show that the use of AMV CP can produce resistance to a range of AMV strains but the resistance may not extend to all strains.
Although a number of laboratory and greenhouse studies have shown that AMV resistant plants can be produced by modifying plants with AMV CP sequences, only one field study with transgenic tobacco has been published previously (Xu et al., 1998). That study demonstrated that plants modified with AMV 425 CP sequences had significantly improved resistance to a different strain, AMV-KY. Our study indicates that a useful level of field resistance can be obtained in pea with transgenic lines expressing the AMV CP. A critical test will be to subject resistant transgenic lines to naturally occurring, aphid-borne AMV epidemics, including infection with a number of strains.
 |
ACKNOWLEDGMENTS
|
|---|
The authors thank John Fletcher for providing NZ34, Richard Forster for providing the cloned NZ1 sequence and the NZ1(Lincoln) viral inoculum, Richard Larsen for providing anti-AMV antisera, Marcus Greven for statistical assistance, Tony Conner and Tracy Williams for critical reading of the manuscript, and Jill Reader, Tracy Dale, Sylvia Erasmusson, and Wendy Fifield for technical assistance.
 |
NOTES
|
|---|
The research was funded by the New Zealand Foundation for Research, Science and Technology.
Received for publication May 13, 2000.
 |
REFERENCES
|
|---|
- An, G., P.R. Ebert, A. Mitra, and S.B. Ha. 1988. Binary vectors. p. A3:119. In S.B. Gelvin et al. (ed.) Plant molecular biology manual. Kluywer Academic Publishers, Dordrecht, the Netherlands.
- Anderson, E.J., D.M. Stark, R.S. Nelson, P.A. Powell, N.E. Tumer, and R.N. Beachey. 1989. Transgenic plants that express the coat protein genes of tobacco mosaic virus or alfalfa mosaic virus interfere with disease development of some nonrelated viruses. Phytopathology 79:12841290.
- Beachey, R.N. 1997. Mechanisms and applications of pathogen-derived resistance. Curr. Opinion Biotechnol. 8:215220.[Web of Science][Medline]
- Charity, J.A., M.A. Anderson, D.J. Bittisnich, M. Whitecross, and T.J.V. Higgins. 1999. Transgenic tobacco and peas expressing a proteinase inhibitor from Nicotiana alata have increased insect resistance. Mol. Breed. 5:357365.
- Chowrira, G.M., T.D. Cavileer, S.K. Gupta, P.F. Surquin, and P.H. Berger. 1998. Coat protein-mediated resistance to pea enation mosaic virus in transgenic Pisum sativum L. Transgenic Res. 7:265271.[Web of Science][Medline]
- Chrispeels, M.J., M.F.G. Desa, and T.J.V. Higgins. 1998. Genetic engineering with alpha-amylase inhibitors makes seeds resistant to bruchids. Seed Sci. Res. 8:257263.
- Fletcher, J.D. 1993. Surveys of virus diseases in pea, lentil, dwarf and broad bean crops in South Island, New Zealand. N.Z. J. Crop Hort. Sci. 21:4553.
- Gallie, D.R., D.E. Sleat, J.W. Watts, P.C. Turner, and T.M.A. Wilson. 1987. The 5'-leader sequence of tobacco mosaic virus RNA enhances the expression of foreign gene transcripts in vitro and in vivo. Nucleic Acids Res. 15:32573273.[Abstract/Free Full Text]
- Grant, J.E., P.A. Cooper, B.J. Gilpin, S. J. Hoglund, J.K. Reader, M.D. Pither-Joyce, and G.M. Timmerman-Vaughan. 1998. Kanamycin is effective for selecting transformed peas. Plant Sci.139:159164.
- Hill, K.K., N. Jarvis-Eagan, E.L. Halk, K.J. Krahn, L.W. Liao, R.S. Mathewson, D.J. Merlo, S.E. Nelson, K.E. Rashka, and L.S. Loesch-Fries. 1991. The development of virus-resistant alfalfa, Medicago sativa L. Bio/Technology 9:373377.[Medline]
- Jaspars, E.M.T., and L. Bos. 1980. Alfalfa mosaic virus. CMI/AAB Descriptions of plant viruses, September 1980, no. 229 (No. 46 revised) (see also http://www.agdia.com/cgi_bin/catalog.cgi/87600; verified January 9, 2001).
- Jones, A.L., I.E. Johansen, S.J. Bean, I. Bach, and A.J. Maule. 1998. Specificity of resistance to pea seed-borne mosaic potyvirus in transgenic peas expressing the viral replicase (NIb) gene. J. Gen. Virol. 79:31293137.[Abstract]
- Liew, O.W. 1994. Expression of atrial natriuretic factor in transgenic potatoes. PhD Dissertation. Lincoln University, Lincoln, New Zealand.
- Loesch-Fries, L.S. 1990. Transgenic plants resistant to plant viruses. UCLA Symp. Mol. Cell Biol. 112:628638.
- Loesch-Fries, L.S., D. Merlo, T. Zinnen, L. Burhop, K. Hill, K. Krahn, N. Jarvis, S. Nelson, and E. Halk. 1987. Expression of alfalfa mosaic virus RNA 4 in transgenic plants confers virus resistance. EMBO J. 6:18451851.[Web of Science][Medline]
- Lomonossoff, G.P. 1995. Pathogen-derived resistance to plant viruses. Annu. Rev. Phytopathol. 33:323343.[Web of Science]
- Matzke, A.J.M., and M.A. Matzke. 1995. Trans inactivation of homologous sequences in Nicotiana tabacum. p. 114. In P. Meyer (ed.) Gene silencing in higher plants and related phenomena in other eukaryotes. Springer, Berlin Heidelberg New York.
- Meyer, P. 1995. Understanding and controlling transgene expression. Trends Biotechnol. 13:332337.
- Morton, R.L., H.E. Schroeder, K.S. Bateman, M.J. Chrispeels, E. Armstrong, and T.J.V. Higgins. 2000. Bean alpha-amylase inhibitor 1 in transgenic peas (Pisum sativum) provides complete protection from pea weevil (Bruchus pisorum) under field conditions. Proc. Natl. Acad. Sci. (USA) 97:3820-3825.[Abstract/Free Full Text]
- Stam, M., J.N.M. Mol, and J.M. Kooter. 1997. The silence of genes in plants. Ann. Bot. 79:312.[Abstract/Free Full Text]
- Timmerman, G.M., T.J. Frew, A.L. Miller, N.F. Weeden, and W.A. Jermyn. 1993. Linkage mapping of sbm-1, a gene conferring resistance to pea seed-borne mosaic virus, using molecular markers in Pisum sativum. Theor. Appl. Genet. 85:609615.
- Tumer, N.E., K.M. O'Connell, R.S. Nelson, P.R. Sanders, R.N. Beachy, R.T. Fraley, and D.M. Shah. 1987. Expression of alfalfa mosaic virus coat protein gene confers cross-protection in transgenic tobacco and tomato plants. EMBO J. 6:11811188.[Web of Science][Medline]
- Van Dun, C.M.P., J.F. Bol, and L. van Vloten-Doting. 1987. Expression of alfalfa mosaic virus and tobacco rattle virus coat protein genes in transgenic tobacco plants. Virology 159:299305.[Web of Science]
- Van Dun, C.M.P., B. Overduin, L. van Vloten Doting, and J.F. Bol. 1988. Transgenic tobacco expressing tobacco streak virus or mutated alfalfa mosaic virus coat protein does not cross-protect against alfalfa mosaic virus infection. Virology 164:383389.[Web of Science][Medline]
- Xu, D., G.B. Collins, A.G. Hunt, and M.T. Nielsen. 1998. Resistance to alfalfa mosaic virus in transgenic burley tobaccos expressing the AMV coat protein gene. Crop Sci. 38:16611668.[Abstract/Free Full Text]