Crop Science 41:522-526 (2001)
© 2001 Crop Science Society of America
CELL BIOLOGY & MOLECULAR GENETICS
The Naturally Occurring High Oleate Oil Character in Some Peanut Varieties Results from Reduced Oleoyl-PC Desaturase Activity from Mutation of Aspartate 150 to Asparagine
Ann C. Bruner,
Sook Jung,
Albert G. Abbott and
Gary L. Powell
Dep. of Biological Sciences, Clemson Univ., Clemson, SC 29634-0326
Corresponding author (glpwl{at}clemson.edu)
 |
ABSTRACT
|
|---|
Commercially important high oleate seed oils, meaning that they are low in polyunsaturated fatty acid content, are resistant to developing rancidity. A peanut cultivar (Arachis hypogaea L.) derived from a naturally occurring peanut has low oleoyl-PC desaturase activity, the key enzyme in the production of linoleate, normally an abundant polyunsaturated fatty acid. Two genes for this enzyme are expressed in peanut seeds, and when they were separately expressed in yeast (Saccharomyces cerevisiae), one produced less linoleate than the other. Although the two cDNA encode similar sequence proteins, they differ by four amino acids. Aspartate at position 150 was asparagine in the low activity copy. An aspartate was present in many membrane desaturases and other related membrane enzymes at an equivalent location suggesting that the mutation at 150 was key to the low activity. In this work, site-specific mutagenesis was used to change the aspartate in the high activity enzyme to asparagine and to change asparagine in the lower activity enzyme to aspartate. These changes, upon expression in yeast, resulted in nearly complete loss of activity of the previously more active desaturase and restored activity to the previously less active desaturase. This decrease in activity of the one gene, a consequence of mutation from aspartate 150 to asparagine, together with reduction in transcript level of the high activity gene in the mutant variety, suggest that these alterations are the molecular basis of the high oleate phenotype in some commercial varieties of peanut.
Abbreviations: PC, phosphatidylcholine
|
INTRODUCTION
|
|---|
SEEDS from peanut or ground nut are the world's fourth largest edible oilseed crop, just behind sunflower (Helianthus annuus L.), providing 4.2 x 106 Mg in 1997-1998 (USDA, 1999). About 80 x 106 kg of peanut oil was produced in the USA in 1997. Peanut oil, like any other plant oil is composed almost entirely of triacylglycerols, a glycerol moiety esterified to three fatty acids. Major fatty acyl groups found in peanut oil are palmitate (10%), a saturated fatty acid, oleate (36–67%), a monounsaturated fatty acid, and linoleate (15–43)% that contains a second double bond. Polyunsaturated fatty acids, available after hydrolysis of the acyl residues from acyl glycerols, are essential in the diets of mammals. However, polyunsaturates are easily oxidized, degrading the nutritional quality. More noticeably, improperly stored oils containing oxidized fatty acids have unpleasant odors and tastes; they quickly become rancid. Thus the content and condition of the polyunsaturated fatty acids in oils is the most important determinant of oil quality.
The compositions of seed oils can be varied by selective breeding with little effect on the agronomic characteristics of the plant. For example, a high oleate peanut cultivar called SunOleic 95R has been developed by the University of Florida, in which the polyunsaturated fatty acyl content of the seed oil was greatly reduced. This high oleate peanut originated from a naturally occurring variety and contained 80.6% oleate and 2.8% linoleate (Gorbet and Knauft, 1997). A similar cultivar, GK-7 High Oleic, has been released by AgraTech. Linolenate, a triply unsaturated fatty acid often present at the level of 5%, was undetectable in the high oleate oil, most likely because linoleate, the immediate biosynthetic precursor, had been greatly reduced in concentration. The reduced polyunsaturates mean that the oil, now much like olive oil in composition, has a much longer shelf-life than the usual peanut varieties before exhibiting rancidity (O'Keefe et al., 1993). Note that this is accomplished without further chemical treatment like hydrogenation, which although it does reduce the unsaturation, introduces undesirable trans fatty acids. Additionally, high oleate, whole peanuts remain fresh longer (Mugendi et al., 1998), an important property for increasing the shelf life of peanut products such as candy.
Linoleate is biosynthesized in a single enzymatic step from oleate by a desaturase that inserts a double bond into a monounsaturated fatty acid like oleate one methylene group removed from the existing double bond. One class of desaturases functions in chloroplasts. But the major desaturase involved in the formation of seed oil during seed development is the oleoyl-PC desaturase, found in microsomes. This desaturase acts on fatty acyl residues present in phospholipids, chiefly phosphatidylcholine (PC) in cell membranes from higher plants like peanut. Biochemical comparison of developing seeds from mutant and parental varieties of peanut showed that the high oleate phenotype was correlated with reduced activity of the microsomal oleoyl-PC desaturase. Possible effects on the activities of 1-acyl-2-lyso-sn-glycero(3) phosphocholine:acyl-CoA acyl transferase, that can transfer fatty acyl groups from acyl-CoA into phospholipids, cytochrome b5, the chief electron donor, for this activity, and cytochrome b5 reductase were ruled out (Ray et al., 1993). The oleoyl-PC desaturase was the target of the gene suppression providing the high oleate varieties of soybean [Glycine max (L.) Merr.] and canola (Brassica ssp.) (Mazur et al., 1999 and references therein).
While the biochemical basis of the high oleate trait in these plant materials seemed clear, the molecular changes leading to this trait in peanut have been less apparent. Our laboratories (Jung et al., 2000a) have isolated two cDNA for the microsomal oleoyl-PC desaturase, ahFAD2A and ahFAD2B. This finding was consistent with the cultivated peanut (A. hypogaea) being an allotetraploid. These different cDNA are thought to come from two very similar, homeologous genes each derived from the two diploid progenitor species Arachis duranensis and A. ipaensis (Jung et al., 2000a) in an evolutionarily old event that fused these two diploid genomes resulting in the cultivated allotetraploid species. The transcripts were of similar size as shown by Northern Blotting. But by exploiting differences in the base sequences in the RT-PCR products from these two genes, it was possible to compare the transcript levels for the two different mRNA. The amount of the ahFAD2B transcript was markedly reduced in plants with the high oleate trait (Jung et al., 2000b). The reading frames from these two cDNA were inserted into the pYES2 vector under control of the GAL1 gene and expressed in the appropriate strain of S. cerevisiae. The ahFAD2A in this construction had about 40% the activity of the ahFAD2B. This decreased activity was consistent with the observed inheritance of the high oleate phenotype in the developing peanut seed (Jung et al., 2000b).
Comparisons of the base sequences of the reading frames of the two genes showed 11 base pair differences resulting in four amino acids differences (Fig. 1)
. Data for sequences of the oleoyl-PC desaturases in A. hypogaea, A. duranensis A. Krapovickas & W.C. Gregory, A. ipaensis A. Krapovickas & W.C. Gregory, Arabidopsis thaliana (L.) Heynh., two isozymes in soybean, sunflower, and Crepis palaestina Bornmuller showed additional variability. But the amino acid corresponding with aspartic acid 150 (Table 1) was conserved in all these enzymes. The sequences for linoleoyl-PC desaturase from Synechococcus and epoxygenase and acetylenase from Crepis are enzymes that are also lipid-modifying enzymes (Table 2), and showed conservation of the aspartic acid nine amino acids past the second histidine-rich region, SHRXHHS. This is one of the three histidine-rich sequences always conserved in this family of enzymes (Shanklin et al., 1994; Shanklin and Cahoon, 1998). In contrast, the gene ahFAD2A has a point mutation in codon position one, converting aspartate 150 to asparagine (D150N) (Jung et al., 2000b).
View larger version (49K):
[in this window]
[in a new window]
|
Fig. 1. Comparison of the amino acid sequences corresponding to ahFAD2B and ahFAD2A. The top line is the most active fad2 sequence, ahFAD2B. The second line is ahFAD2A. The conserved histidine regions, putative binding sites for diiron (Shanklin et al., 1994) are in italics. The four unmatched amino acids are underlined. Amino acid 150 (numbered at right), adjacent to the second histidine-rich region, (bold) was mutagenized
|
|
View this table:
[in this window]
[in a new window]
|
Table 2. Fatty acid composition for yeast expressing different oleoyl-PC desaturases. The relative percentages of six fatty acids (components exceeding 2% of the total) from the total lipids present in yeast transformed with pYES2 containing the indicated inserts are shown. The data are for 2-4 individually selected clones grown as described, induced with galactose for eight hours, and the fatty acid methyl esters analyzed by gas-liquid chromatography. A typical variation for the duplicate samples is indicated in the first row. The identity of 16:2 was verified by mass spectroscopy using dimethyl disulfide (Yamamoto et al., 1991). The row labeled empty vector was for the INVSc1 strain of S. cerevisiae cells transformed with pYES2 (lacking insert) that was grown and induced under conditions identical to those used for the other constructions. The composition shown was not noticeably different from that obtained for uninduced cells or for untransformed INVSC1 cells
|
|
This coincidence directed our attention to this amino acid as a candidate for site-specific mutation. The aim was to determine if this single amino acid change was the cause of the decreased activity in the mutated oleoyl-PC desaturase that correlated with the high oleate trait in these peanut cultivars.
|
MATERIALS AND METHODS
|
|---|
Site Specific Mutagenesis and Vector Construction
The cDNA corresponding with ahFAD2A and ahFAD2B, were isolated from the 
GT11 (Promega) cDNA libraries (Jung et al., 2000a) from developing peanut seed and contained base sequences extending in front of and after the putative reading frames. The primers used to mutagenize ahFAD2B were as follows: Primer 1—5'CGACCGCAACGAAGTGTTTG; Primer 2—5'CGTTTCCAACTCGAGCTATGCATCAGAAC; and Primer 3—5'CCGGATCCTTAACAACACAACAATGGG. The mutation in Primer 1 is shown in bold. The XhoI cutting site in Primer 2 and the BamHI cutting site in Primer 3 are italicized. The first PCR reaction used Primer 1, containing the mutation and Primer 2, complementary to the 3' end. The PCR products from this first reaction, freed of excess Primers 1 and 2, contain the megaprimer with the mutated base. The megaprimer (Sarkar and Sommer, 1990) was used in a second PCR reaction with 5' primer specific for the 5' end of the reading frame. Mutagenesis of ahFAD2A was carried out identically but with the substitution of G for A (bold) in Primer 1 so that N150D. The entire unmutated reading frame from ahFAD2A and ahFAD2B was also amplified from single PCR reactions with the same forward and reverse primers containing the BamHI and XhoI cutting sites, respectively, forming unmutated PCR products. The conditions were 0.5 pmol pYES2 vector containing ahFAD2A or ahFAD2B, 0.25 mM of each dNTP, 15 pmol forward and 15 pmol reverse primer, 25 units cloned Pfu DNA polymerase (Stratagene, La Jolla, CA), and buffer (10 mM KCl, 10 mM (NH4)2SO4, 20 mM Tris-Cl (pH 8.75), 2 mM MgSO4, 0.1% (v/v) Triton X-100, 0.1 mg mL-1 bovine serum albumin) in a final volume of 25 µL. The reaction was heated to 94°C for 4 min, then 94°C/1 min, 57°C/2 min, 72°C/1 min for 30 cycles, held at 72°C for 5 min and stored at 4°C. The PCR product from the first reaction was separated from excess primers using the Centricon 100 concentrator (Amicon, Beverly, MA). The retentate containing the megaprimer was treated with phenol/CHCl3 and precipitated with ethanol before it was used in the second PCR reaction.
The product containing the full reading frame after the second PCR reaction was ligated into the pCR plasmid as described (Zero Blunt PCR Cloning Kit, Invitrogen, Carlsbad, CA), with Zeocin selection. The correctness of the construction was verified in the pCR plasmids by dye primer sequencing (4200L system, LI-COR, Inc., Lincoln, NE) with forward and reverse primers specific for M13. Inserts were released from amplified pCR plasmid by digestion with BamHI and XhoI, gel purified, and ligated into the cut pYES2 shuttle vector (Invitrogen, Carlsbad, CA). The amplified pYES2 vectors with inserts were used to transform S. cerevisiae INVSC1 (Invitrogen, Carlsbad, CA) and transformant were selected on solid media lacking uracil [SC-ura with 2% (w/v) glucose—Adams et al., 1997]. The presence of plasmid in S. cerevisiae was verified by plasmid rescue (Adams et al., 1997) by transforming competent E. coli DH5
with DNA recovered from putatively transformed yeast and selection on ampicillin. Nutritional requirements for his, leu, and trp (his, leu, trp, ura DO supplement, Clontech, Palo Alto, CA) for the cultures supported the identity of the transformed yeast cells as INVSC1.
Expression of Oleoyl-PC Desaturase Contained in pYES2 Vector
Transformed yeast was grown from frozen stocks on synthetic liquid medium lacking uracil (SC-ura) supplemented with 2% (w/v) raffinose as sole carbon source and grown at 32°C. Once the A600 of the sample was approximately 0.5, galactose was added to 2% (w/v), and the cells were allowed to shake for 8 h. Cells were then harvested. The washed cell pellets were treated with 0.5 M sodium methoxide in methanol (Sigma-Aldrich, St. Louis, MO) for 30 min at room temperature, acidified with dilute sulfuric acid, and extracted into hexane for gas chromatographic analysis. Analysis was done with the H/P 5890 gas chromatograph equipped with automated samples using a column 30-m by 0.25-mm ID coated with 0.25-mm poly(alkyleneglycol) film (SP-2380, Sigma-Aldrich-Supelco, St. Louis, MO). The temperature was programmed from 150°C for 2 min, then to 220°C at 2°C/min using He at 20 cm/s with the efflux split 100:1. Effluent was detected with a flame ionization detector, identified, and integrated using the 5900 gas chromatograph (Hewlett-Packard, Palo Alto, CA). The identities of the diunsaturated fatty acids were verified by the method of Yamamoto et al., 1991.
|
RESULTS AND DISCUSSION
|
|---|
Enzymes that modify lipids in higher plants have frequently been difficult to characterize. Many such enzymes have low activities and are present in low concentrations in plant materials and are frequently localized in special tissues and at particular times during development. Often they are membrane enzymes, with all the attendant difficulties of purification and characterization. The ability to isolate cDNA encoding the genes for these enzymes and to express these activities lends a new dimension to their study and characterization.
Because difficulties had been encountered expressing the oleoyl-PC desaturase by means of bacteria-based expression systems (our unpublished observations), it was an important advance to be able to use yeast expression for the study of this membrane-localized activity (Covello and Reed, 1996). The reading frames for both cDNA isolated from peanut for the oleoyl-PC desaturase (FAD2), ahFAD2A and –B were placed within the pYES2 expression vector where they are regulated by the GAL1 operon. When induced by the addition of galactose to the yeast cultures, the amount of protein translated was driven by this regulatory element, not putative elements present in the native plant 5' and 3' untranslated regions, because they were omitted from these constructions.
The amino acid sequence for the two cDNA obtained for the peanut oleoyl-PC desaturase (Jung et al., 2000a) differed by four amino acids. For the reasons described above (see Table 1 in the introductory section and the associated discussion), the influence of mutation of the amino acid found at location 150 on the activity was of special interest. The asparagine in ahFAD2A was mutated to aspartate (N150D) providing ahFAD2A-D; similarly ahFAD2B was mutated (D150N) to ahFAD2B-N. These mutations left the three other amino acids that differed unchanged. When expressed in yeast, this single amino acid mutation reduced the most active ahFAD2B oleoyl-PC desaturase to barely detectable levels in ahFAD2B-N while the formerly less active ahFAD2A was made as active as the native desaturase in ahFAD2A-D (see Table 2). These observations support the suggestion that aspartate 150 was an essential amino acid and part of the active site for this enzyme, consistent with the data in Table 1. Loss of this essential aspartate in transcript ahFAD2A, and the resulting decrease in activity, is most likely the biochemical basis of the high oleate phenotype in this mutant.
The linoleate content in cells expressing ahFAD2A (7.8%) was about 40% the content of that for ahFAD2B (18.3%). However, when aspartic acid 150 was mutagenized to asparagine in ahFAD2B, the linoleate accumulation (0.9%) was very low (Table 2). One explanation for the intermediate activity of the ahFAD2A construction is that one or more of the remaining three different amino acids could partially compensate for the change caused by the substitution of asparagine for aspartate 150, thereby enhancing the otherwise negligible activity of the desaturase in the absence of the aspartic acid (ahFAD2B-N).
The oleoyl-PC desaturase also desaturated endogenous forming 9(Z), 12(Z) hexadecadienoate (Table 2) as previously observed (Covello and Reed, 1996). This fatty acid was also observed when fad6 activity was expressed in cyanobacterium (Hitz et al., 1994). While the fraction of palmitoleate was greater than oleate, the hexadecadienoate, following induction of oleoyl-PC activity, was much less abundant than linoleate. Moreover, when ahFAD2A was mutated to ahFAD2A-D, the amount of hexacadienoate decreased instead of increasing as did linoleate (Table 2). This discrepancy could reflect a decrease in the specificity for the shorter chain of palmitoleate for ahFAD2A-D.
Observations on the differing chain length specificity of ahFAD2A and ahFAD2A-D, with ahFAD2B and ahFAD2B-N as well as any other quantitative differences in activity (see above) could reflect differences in expression in yeast rather than in peanut tissues. To compare the activities, that is, the amount of linoleate that accumulated in yeast cells 8 h after induction with galactose, one must assume peptides differing in a few amino acids to be transcribed in similar amounts. At present, we have no estimate of the amount of enzyme formed nor of its stability. The linoleate resulted from enzyme action on membrane lipid diffusing to and accessible to the expressed enzyme. Therefore, the expressed enzyme could have been active over this entire period or each copy may have been quickly degraded following synthesis with individual molecules having some active life appreciably shorter than 8 h. The observed activity also implied that the membrane-associated peptide folded correctly within the endoplasmic reticulum and associated properly with other copies of the desaturase, if the enzyme is multimeric. Because cytochrome b5 is an essential cofactor for oleoyl-PC desaturase (Smith et al., 1990; Kearns et al., 1991) and is found predominantly within the endoplasmic reticulum in yeast (Yoshida et al., 1974), at least some of the oleoyl-PC desaturase protein was directed to the endoplasmic reticulum by the signal portion of the peptide. Interestingly, when enzyme activities for oleoyl-PC desaturase and the hydroxylase which resulted from mutagenesis, were compared in heterologous systems by examining fatty acid composition by gas chromatography, the results obtained from Arabidopsis were very similar for the expression in Saccharomyces (Broun et al., 1998). This observation suggested that the environment for oleoyl-PC desaturase in yeast is similar to that in plants. This conclusion is consistent with our bias, but additional work will be required to examine each of the above features of expression of the oleoyl-PC desaturase in yeast to be certain of the suggestions that come from linoleate accumulation in this yeast induction system.
In conclusion, these data suggest that aspartic acid at position 150 in the ahFAD2 oleoyl-PC desaturase is an essential residue for the synthesis of linoleate from oleate. The proximity of this residue nine positions removed from the last histidine of the second histidine-rich region, together with the effects on activity, imply that aspartate 150 lies within the active site of this enzyme. This conclusion is fully supported by the deduced amino acid sequences in oleoyl-PC desaturases and related enzymes from a variety of plants (Table 1). The marked effect of this point mutation in ahFAD2A on the activity of the enzyme, together with an unknown mechanism for the loss of transcription of ahFAD2B (Jung et al., 2000a), seem to be the molecular basis of the high oleate phenotype in these peanut varieties.
|
ACKNOWLEDGMENTS
|
|---|
Evann Thies and Melissa Riley expertly analyzed the fatty acid methyl esters by gas chromatography and mass spectral analysis, respectively. The work was partially supported by a grant from AgraTech Seeds Inc., Ashburn, GA, and from the South Carolina Experiment Station at Clemson University.
|
NOTES
|
|---|
This work was partially supported by grants from the South Carolina Exp. Stn., Clemson Univ., and by a grant from AgraTech Seeds Inc., Ashburn, GA.
Received for publication March 8, 2000.
|
REFERENCES
|
|---|
- Adams, A., D. Gottschling, and T. Stearns. 1997. Methods in yeast genetics: A laboratory course manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
- Broun, P., J. Shanklin, E. Whittle, and C. Somerville. 1998. Catalytic plasticity of fatty acid modification enzymes underlying chemical diversity of plant lipids. Science 282:1315–1317.[Abstract/Free Full Text]
- Covello, P.S. and D.W. Reed. 1996. Functional expression of the extraplastidial Arabidopsis thaliana oleate desaturase gene (FAD2) in Saccharomyces cerevisiae. Plant Physiol. 111:223–226.[Abstract]
- Gorbet, D.W. and D.A. Knauft. 1997. Registration of SunOleic 95R Peanut. Crop Sci. 37:1392.[Free Full Text]
- Mugendi, J.B., C.A. Sims, D.W. Gorbert and S.F. O'Keefe. 1998. Flavor stability of high-oleic peanuts stored at low humidity. JOACS 75:21–25.
- Hitz, W.D., T.J. Carlson, J.R. Booth, A.J. Kinney, K.L. Stecca, and N.S. Yadav. 1994. Cloning of a higher-plant plastid
-6 fatty acid desaturase cDNA and its expression in a cyanobacterium. Plant Physiol. 105:635–641.[Abstract]
- Jung, S., D. Swift, E. Sengoku, M. Patel, F. Teule, G. Powell, K. Moore, and A. Abbott. 2000a. High oleate trait in the cultivated peanut [Arachis hypogaea L]: I. Isolation and characterization of two microsomal oleoyl-PC desaturases. Mol. Gen. Genet. 263:796–805.[ISI][Medline]
- Jung, S., G. Powell, K. Moore, and A. Abbott. 2000b. High oleate trait in the cultivated peanut [Arachis hypogaea L.]: II. Molecular basis and genetics of the trait. Mol. Gen. Genet. 263:806–811.[ISI][Medline]
- Kearns, E.V., S. Hugly, C.R. Somerville. 1991. The role of cytochrome b5 in delta 12 desaturation of oleic acid by microsomes of safflower (Carthamus tinctorius L.). Arch. Biochem. Biophys. 284:431–436.[ISI][Medline]
- Mazur, B., E. Krebbers, and S. Tingey. 1999. Gene discovery and product development for grain quality traits. Science 285:372–375.[Abstract/Free Full Text]
- O'Keefe, S.F., V.A. Wiley, and D.A. Knauft. 1993. Comparison of oxidative stability of high- and normal-oleic peanut oils. JAOCS 70:489–492.
- Ray, T.K., S.P. Holly, D.A. Knauft, A.G. Abbott, and G.L. Powell. 1993. The primary defect in developing seed from the high oleate variety of peanut (Arachis hypogaea L.) is the absence of
12-desaturase activity. Plant Sci. 91:15–21.
- Sarkar, G. and S.S. Sommer, 1990. The "megaprimer" method of site-directed mutagenesis. BioTechniques 8:404–407.[ISI][Medline]
- Shanklin, J., E. Whittle, and B.G. Fox. 1994. Eight histidines are catalytically essential in a membrane-associated iron enzyme, stearoyl-CoA desaturase, and are conserved in alkane hydroxylase and xylene monooxygenase. Biochemistry 33:12787–12794.[Medline]
- Shanklin, J. and E.B. Cahoon, 1998. Desaturation and related modifications of fatty acids. Annu. Rev. Plant Physiol. Plant. Mol. Biol. 49:611–641.[ISI][Medline]
- Smith, M.A., A.R. Cross, O.T. Jones, W.T. Griffiths, S. Stymne, and K. Stobart. 1990. Electron-transport components of the 1-acyl-2-oleoyl-sn-glycero-3-phosphocholine 12-desaturase (12-desaturase) in microsomal preparations from developing safflower (Carthamus tinctorius L.) cotyledons. Biochem. J. 272:23–29.[ISI][Medline]
- U.S. Department of Agruculture. 1999. Agricultural Statistics. p. III-8, 25. U.S. Gov. Print. Office, Washington, DC.
- Yamamoto, K., A. Shibahara, T. Nakayama, and G. Kajimoto. 1991. Determination of double-bond position in methylene-interrupted dienoic fatty acids by GC-MS as their dimethyl disulfide adducts. Chem. Phys. Lipids 69:39–50.
- Yoshida, Y., H. Kumaoka, and R. Sato. 1974. Studies on the microsomal electron-transport system of anaerobically grown yeast. II. Purification and characterization of cytochrome b5. J. Biochem. (Tokyo) 75:1211–1219.[Abstract/Free Full Text]
This article has been cited by other articles:
|
|
|
|
 
Y. Chu, L. Ramos, C. C. Holbrook, and P. Ozias-Akins
Frequency of a Loss-of-Function Mutation in Oleoyl-PC Desaturase (ahFAD2A) in the Mini-Core of the U.S. Peanut Germplasm Collection
Crop Sci.,
November 7, 2007;
47(6):
2372 - 2378.
[Abstract]
[Full Text]
[PDF]
|
|
|
TOP
ABSTRACT
INTRODUCTION
