Crop Science Grow Your Career with CSSA
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brahm, L.
Right arrow Articles by Friedt, W.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Brahm, L.
Right arrow Articles by Friedt, W.
Agricola
Right arrow Articles by Brahm, L.
Right arrow Articles by Friedt, W.
Crop Science 40:676-682 (2000)
© 2000 Crop Science Society of America

CROP BREEDING, GENETICS & CYTOLOGY

PCR-Based Markers Facilitating Marker Assisted Selection in Sunflower for Resistance to Downy Mildew

Lutz Brahm, Thomas Röcher and Wolfgang Friedt

Institute of Crop Science and Plant Breeding, Justus-Liebig-University, Ludwigstr. 23, D-35390 Giessen, Germany

wolfgang.friedt{at}agrar.uni-giessen.de


   ABSTRACT
TOP
 ABSTRACT
INTRODUCTION
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Sunflower (Helianthus annuus L.) production is endangered by several diseases, necessitating sophisticated disease management strategies. Downy mildew of sunflower, incited by Plasmopara halstedii (Farl.) Berl. et de Toni, is a major sunflower disease. Recent reports of pathotypes resistant to metalaxyl [N-(2,6-dimethylphenyl)-N-(methoxyacetyl)-DL-alanine methyl ester], which was used as a seed treatment against downy mildew, showed the necessity to breed for durable downy mildew resistance in future hybrids. This process can be accelerated by marker assisted selection (MAS) including pyramiding of several resistance genes. The objective of this study was to develop molecular markers for the Pl2 gene of cultivated sunflower, which confers resistance to downy mildew races 1, 2, 7, and 9. Two sets of near isogenic lines (AS110/AS110Pl2 and S1358/S1358Pl2) and bulks of a segregating F2 population were used to identify random amplified polymorphic DNA (RAPD) and amplified fragment length polymorphism (AFLP) markers. Public maintainer and restorer lines were used to evaluate the markers. Disease resistance was evaluated by the whole seedling immersion method. DNA was extracted from leaves at flowering. RAPD markers OPAA14750 and OPAC20831, as well as the AFLP marker E35M48-3, showed a tight linkage of about 2 centimorgans (cM) to the Pl2 locus. RAPD marker OPAA111008 linked to a distance of about 6 cM with the resistance locus and could be converted to a SCAR marker. Closely linked RAPDs and the sequence characterized amplified region (SCAR) marker demonstrated their practicability for marker assisted breeding by differentiating between resistant and susceptible germplasm of a set of diverse sunflower inbred lines.

Abbreviations: AFLP, amplified fragment length polymorphism • cM, centimorgan • MAS, marker assisted selection • PCR, polymerase chain reaction • RAPD, random amplified polymorphic DNA • RFLP, restiction fragment length polymorphism • SCAR, sequence characterized amplified region • STS, sequence tagged site


   INTRODUCTION
TOP
 ABSTRACT
 INTRODUCTION
Materials and methods
 Results
 Discussion
 REFERENCES
 
SUNFLOWER is one of the most important annual oilseed crops. Because of the development of modern hybrid cultivars, the sunflower growing area in Europe increased from 1.4 million hectares in 1970 to about 4.0 million hectares today (excluding areas in the former USSR). However, sunflower production is endangered by a number of pathogens. Among the sunflower diseases, downy mildew, caused by Plasmopara halstedii, is a major problem. Resistance to downy mildew, as well as chemical seed treatments with metalaxyl, have been used for plant protection. Recent reports of metalaxyl-resistant downy mildew pathotypes in field collections from France (Albourie et al., 1998) demonstrate the adaptability of the pathogen. Therefore, the use of resistant hybrids in a prudent disease management strategy will be the major task for plant protection of sunflower in the future.

A number of major resistance genes have been either identified in cultivated sunflower or were introduced from wild H. annuus or other wild Helianthus species (Korell et al., 1996a; Miller, 1992). These dominant resistance genes have been designated as Pl genes. Some of them provide resistance to a single race of downy mildew, whereas others impart resistance against two or more races (Miller, 1992). At the moment, most commercial hybrids are resistant to race 2 of downy mildew (Gulya, 1998), which was the predominant race in the USA until 1981 (Gulya et al., 1991b). Six hybrids were resistant to the most virulent pathotype (race 5). Most breeders acknowledged that the resistance was obtained from public USDA lines HA335 through HA339 that are resistant to all races (Gulya, 1998). It may be very attractive for practical breeding to use, for example, the Pl6 gene, which provides resistance to all known races. However, it is not advisable to use only one resistance gene. Rather, several different resistance genes should be employed, either by growing different hybrids carrying the different resistance genes or by pyramiding such genes. This strategy may extend the life cycle of each gene by keeping the selection pressure on the pathogen population as low as possible. Strong resistance genes effective against all known races could be overcome soon by new pathogen races if used alone. On the other hand, hybrids that combine strong genes with already defeated hypostatic genes may be resistant to such new races (Kelly and Miklas, 1998). Hence, the combination of these defeated genes with novel genes, to which the pathogen has not been exposed, will extend the useful life of the defeated genes and will provide more durable resistance (Lawson et al., 1998).

Breeding for resistance to P. halstedii involving different genetic sources could be accelerated through the use of MAS methods. Pyramiding of different resistance genes has been highly effective in controlling stem rust (Puccinia graminis f. sp. tritici) in wheat (Triticum aestivum L.) (Schafer and Roelfs, 1985). However, the pyramiding of different genes providing resistance to downy mildew of sunflower is hindered by some difficulties. First is the growing number of different pathogen isolates, which are necessary to distinguish between the different resistance genes in a conventional selection (Kelly and Miklas, 1998; Melchinger, 1990). Even more important are the problems in differentiating between several Pl genes. A number of the Pl genes show the same reaction to different races of sunflower downy mildew. For example, genes Pl6, Pl7, and Pl8 are all of different origin and effective against all known races. Therefore, resistance tests in a conventional breeding program do not distinguish among genotypes carrying resistance alleles at either one locus or both loci of two different resistance genes. This requires an additional test cycle in the following generation, produced by selfing or by a testcross to totally susceptible genotypes. In addition, as breeders use more and more effective resistance genes controlling a number of pathogen races or even all known races, valuable hypostatic genes (masked by the strong gene) will be lost during conventional selection because of the problem described above (Kelly and Miklas, 1998).

Restiction fragment length polymorphism (RFLP) markers linked to genes Pl1, Pl2, and Pl6 are already available (Mouzeyar et al., 1995; Roeckel-Drevet et al., 1996; Vear et al., 1997). Recently, the application of a candidate gene approach revealed cloned RFLP markers which are located in the Pl region including Pl6 and Pl2 (Gentzbittel et al., 1998) and may therefore detect parts of the clustered genes themselves. However, polymerase chain reaction (PCR) based markers useful for MAS have not been reported. Since the development of RFLP markers is laborious and time consuming and requires large amounts of DNA, PCR-based markers are more suitable for screening large populations in marker assisted breeding programs (Ordon et al., 1999). The selection process will be particularly effective, if the marker analyses can be conducted in a very early developmental stage (Weber and Wricke, 1994), for instance by using "half seeds" (Chungwonse et al., 1993; Wang et al., 1993). Allele specific PCR-based markers like SCAR/STS (sequence tagged site) markers should additionally enhance the power of large scale marker analyses (Gu et al., 1995). Moreover, MAS will enable the simultaneous consideration of several traits, if the markers are available. For example, the recent reports of markers for rust resistance and high oleic acid content in sunflower (Dehmer and Friedt, 1997; Lawson et al., 1998) as well as the markers for downy mildew resistance may facilitate the indirect selection for resistance as well as for oil quality of sunflower.

The Pl2 gene is the first target in a series of resistance genes effective against different races of sunflower downy mildew, as we believe that different Pl genes should be involved in developing sunflower hybrids possessing a durable resistance to P. halstedii. The Pl2 gene was first identified by Zimmer and Kinman (1972) in the inbred line HA61. At that time, HA61 was one of three lines that were resistant to race 2 (Red River race) of downy mildew. Later on, Gulya et al. (1991b) discovered downy mildew races 6 and 7. The composite DM2 was susceptible to both races. The inbred line RHA274 was resistant to races 6 and 7. The line RHA325 was resistant to race 7. Since DM2, RHA274, and RHA325 carry the Pl2 gene, Gulya et al. (1991b) concluded that line RHA274 carries an additional gene Pl9 conferring resistance to race 6. They also postulated that both restorer lines RHA274 and RHA325 posses another gene Pl10, which gives resistance to race 7. However, no inbred lines arose that separated genes Pl2, Pl9, and Pl10 (G. Seiler, 1997, personal communication).

Molecular mapping of genes Pl1, Pl2, and Pl6 revealed the colocation of all three Pl genes (Mouzeyar et al., 1995; Roeckel-Drevet et al., 1996; Vear et al., 1997). Vear et al. (1997) showed that the Pl6 locus consists of at least two very closely linked genes. They postulated that the Pl6 gene is a complex locus, which includes several linked resistance genes. Since the Pl2 gene and the Pl6 locus were colocated, Vear et al. (1997) concluded that the Pl2 locus is a smaller part of the complex locus Pl6. Consequently, they supposed that the Pl2 locus itself is a cluster of closely linked genes.

The objective of this study was to develop molecular markers for the Pl2 gene of cultivated sunflower, which confers resistance to downy mildew races 1, 2, 7, and 9. The markers will facilitate MAS for downy mildew resistance in sunflower.


   Materials and methods
TOP
 ABSTRACT
 INTRODUCTION
 Materials and methods
Results
 Discussion
 REFERENCES
 
Two sets of near isogenic lines AS110/AS110Pl2 and S1358/S1358Pl2 were used for the identification of molecular markers. Both sets were originally developed by Dr. V.A. Vranceanu (Fundulea, Romania) with special reference to the Pl2 locus, conferring resistance against downy mildew races 1, 2, 7, and 9. An F2 population derived from a cross of the male sterile line HA89 with the restorer line AS110Pl2 was used in a bulked segregant analysis (Michelmore et al., 1991) and for linkage analysis. Resistant and susceptible bulks were compiled consisting of 10 homozygous resistant and 10 homozygous susceptible plants. In addition, public maintainer (HA291, HA323, HA342, HA350, HA850, HA-R2, CM594, and CM603) and restorer lines (RHA325, RHA345, RHA348, CM587, CM591, CM592, CM596, and CM610), susceptible or resistant to downy mildew, were screened to evaluate the utility of the detected markers.

Downy mildew resistance was tested applying the whole seedling immersion method described by Gulya et al. (1991a). Resistance of F2 plants was determined by testing 20 to 24 F3 seedlings per F2 individual. Symptoms were observed 2 wk after inoculation, following 72 h under a saturated atmosphere. The genotypes were screened with a field isolate, collected at our breeding station near Frankfurt/Main, Germany. This isolate reacts similarly to American races 7 and 9, according to tests of public USDA lines as differentials (Table 1) . Resistance was defined as absence of sporulation on cotyledons and true leaves. Following the test in the F3 generation, the F2 plants were classified as homozygous susceptible, homozygous resistant, or heterozygous.


View this table:
[in this window]
[in a new window]
  		Table 1 Reaction of public sunflower USDA lines to downy mildew isolate GG-F5

 
DNA was extracted from leaf material collected at flowering according to Doyle and Doyle (1990). DNA content of samples was measured fluorometrically with Hoechst dye 33258 (Hoechst, Frankfurt, Germany). Molecular markers were developed applying RAPD and AFLP techniques by analyzing near isogenic lines (RAPDs) and bulks (RAPDs, AFLPs).

RAPD analysis was performed employing random decamer primers (Operon Technologies, Alameda, CA, Kits A to T, Y, Z, AA to AJ, and AN to AX). Twenty-five nanograms of DNA were used as a template in a total reaction volume of 25 µL containing 10 mM Tris-HCl (pH 8.3), 10 mM KCl, 6 mM MgCl2, 0.4 mM dNTP (MBI Fermentas, St. Leon-Roth, Germany), 0.3 µM of the decamer primer and 1.5 U of AmpliTaq DNA Polymerase Stoffelfragment (Perkin Elmer Cetus, Norwalk, CT). Amplification was performed in a DNA Thermal Cycler 480 or a GenAmp System 9600 (both Perkin Elmer Cetus) with an initial denaturation for 4 min at 94°C followed by 45 cycles of 1 min at 94°C, 1 min at 36°C, and 2 min at 72°C. The extension step was prolonged for 3 s per cycle when using the DNA Thermal Cycler 480. The ramp rate from annealing to extension was restricted to 5°C per min (Brahm and Friedt, 1996). RAPD fragments were analyzed on 2% (w/v) (Nusieve 3:1, FMC BioProducts, Vallensbaek, Denmark) and 1.8% (w/v) (NEEO, Carl Roth GmbH, Karlsruhe, Germany) agarose gels in Tris-borate-EDTA (TBE) buffer and stained with ethidium bromide. AFLP markers were generated by using AFLP Analysis System I (GIBCO BRL/Life Technologies, Rockville, MD). EcoRI specific primers were labeled with [{gamma}-33P]dATP (NEN Life Science, Boston, MA). Amplification and fragment analysis were carried out according to the suppliers protocols.

After amplification each RAPD marker fragment was purified in an agarose gel and excised and recovered with the QIAquick gel extraction kit (Qiagen GmbH, Hilden, Germany). The fragments were ligated in a T/A-vector (pCR2.1, TOPO-TA cloning Kit, Invitrogen, San Diego, CA) and cloned. The presence of each fragment in the clone was assessed in a restriction digestion of plasmids following an alkaline lysis preparation (QIAprep 8 Miniprep Kit, Qiagen). Sequencing of the cloned fragments was performed by dideoxy terminator cycle sequencing (SequiTherm Long-Read Kit, Epicentre Technologies, Madison, WI) with M13 reverse and T7 promotor primers. Sequence analysis was conducted on a LI-COR 4000 automated DNA sequencer (LI-COR Inc., Lincoln, NE).

Two specific oligonucleotides were designed from the sequence of the marker fragments. Each primer consisted of 10-bp original RAPD primer sequence and 8- to 13-bp additional internal sequence. The two primers, SCAA11a (5' ACCCGACCTGCTATAATAATTCC 3') and SCAA11b (5'ACCCGACCTGGGGGACTAC 3'), were used to amplify the specific marker under the following conditions: the 20-µL reaction volume contained 10 mM Tris-HCl (pH 8.3), 1.5 mM MgCl2, 50 mM KCl, 320 µM of each dNTP, 0.2 µM each primer, 0.5 U AmpliTaq Polymerase (Perkin Elmer, Cetus), and 50 ng DNA. Reactions were performed with a Multicycler PTC200 (MJ Research, San Francisco, CA) programmed for 2 min at 94°C, then for 30 cycles of 45 s at 94°C, 45 s at 55°C, and 1 min at 72°C, followed by a final elongation for 10 min at 72°C. The second primer pair, SCAA14a (5' AACGGGCCAACATCAGAATC 3') and SCAA14b (5' AACGGGCCAAGTGAAGGG 3'), were employed under the same reaction conditions, but the annealing temperature was varied from 45 to 60°C in steps of 5°C to evaluate the optimum. However, the specific primers amplified a fragment of 750 bp in size in both, the susceptible and resistant parent.

Linkage analysis was conducted by Mapmaker 3.0 software (Lander et al., 1987). Map units were computed by applying the Kosambi function (Kosambi, 1944). Linkage groups were identified at a minimum LOD score of 3.0 and a maximum distance of 37.2 cM. Map orders were determined by the "order" command for coupling phase markers and the "compare" command for repulsion phase markers following three point analysis. Final map orders were tested by the "ripple" command.


   Results
TOP
 ABSTRACT
 INTRODUCTION
 Materials and methods
 Results
Discussion
 REFERENCES
 
The test for resistance of F2 individuals to sunflower downy mildew prior to the molecular investigations was conducted to confirm the presence of a single dominant resistance gene. The resistance gene Pl2 originating from the inbred line AS110Pl2 segregated in the F2 population of the cross HA89(cms) x AS110Pl2 in the expected 1 : 2 : 1 ratio, i.e. 90 homozygous resistant : 162 heterozygous : 89 homozygous susceptible plants, following the test of 341 F3 progenies ({chi} = 0.65, P = 0.85).

Near isogenic lines AS110 and AS110Pl2, and S1358 and S1358Pl2 were analyzed with 380 RAPD primers in the PCR experiments. A total of 21 of these primers detected fragments that were polymorphic between both pairs of near isogenic lines and were tested on a small subset of the F2 population. Subsequently, primers OPA02, OPB08, OPO04, and OPZ15 revealed additional fragments on the resistant and the susceptible lines (Table 2) , respectively, which are linked to the Pl2 locus. Corresponding to the size of the fragment amplified by each primer, markers were designated OPA02630, OPB08730, OPO04486, and OPZ15700.


View this table:
[in this window]
[in a new window]
  		Table 2 Markers identified for the Pl2 gene analyzing sunflower near isogenic lines (NIL) and bulks (BSA) for downy mildew resistance

 
An additional 540 RAPD primers were tested in the bulked segregant analysis of the F2 population. Moreover, the bulks were screened employing 21 AFLP primer combinations. As a result five more RAPD primers and two AFLP primer combinations amplified additional fragments in the resistant and susceptible bulks (Table 2). RAPD markers were designated OPAA111008, OPAA14750, OPAC20831, and OPAS12280. The AFLP markers were named E35M48-3 and E41M62-2.

Linkage analysis was performed with 243 F2 individuals derived from the cross HA89(cms) x AS110Pl2. All markers were scored as dominant traits. The markers derived from the resistant and susceptible parent, respectively, were used to map the Pl2 locus in separate linkage maps corresponding to each linkage phase (Fig. 1) . Only two of the RAPD markers and one AFLP marker were obtained from the susceptible parent HA89(cms), with OPAS12280 and E41M62-2 linked at about 11 cM and OPO04486 at about 22 cM distance from the Pl2 gene. The remaining markers derived from the resistant restorer line AS110Pl2 covered a genomic region of about 64 cM. Markers OPAA14750, E35M48-3, and OPAC20831 showed the closest linkage to the Pl2 locus and are located approximately 2 cM from the resistance gene.



View larger version (16K):
[in this window]
[in a new window]
  		Fig. 1 Linkage map for the Pl2 locus in sunflower constructed by means of markers in coupling (a) and repulsion (b) phase

 
For the verification of SCAA111008, the segregation of the marker fragment was tested. One hundred twenty-seven individuals in which the RAPD marker OPAA111008 had been scored were screened with specific primers SCAA11a and SCAA11b (Fig. 2) . The SCAR marker was missing in 10 resistant F2 plants. Five of those also were devoid of the RAPD fragment. In the susceptible genotypes, six F2 plants contained SCAA111008, and five of those plants also showed the corresponding RAPD marker. One of the resistant genotypes did not posses the original RAPD marker but did contain SCAA111008, while one of the susceptible plants showed the original RAPD OPAA111008 but did not show the SCAR marker. Hence, the SCAR marker gave more precise data in two cases, but possibly resulted in an incorrect scoring of six F2 plants.



View larger version (53K):
[in this window]
[in a new window]
  		Fig. 2 Segregation of SCAR marker SCAA111008 in the sunflower F2 population derived from the cross HA89(cms) x AS110Pl2. Lane 1, resistant parent AS110Pl2; Lane 2, susceptible parent HA89(cms); Lane 3, resistant bulk; Lane 4, susceptible bulk; Lane M, molecular weight marker (100-bp ladder, Gibco BRL). R = resistant, S = susceptible as tested in F3 (F2 progeny), - = no resistance data available because of sterility of F2 plant

 
The RAPD markers as well as SCAA111008 were tested for their applicability for marker assisted sunflower breeding in different genetic backgrounds. Genomic DNA of a number of public inbreds differing at the resistance locus Pl2 were used as template DNA in the PCR reactions. The closest correlation between marker and resistance locus could be detected for OPAC20831. This marker was present in each of the resistant inbreds and absent in all susceptible lines. OPAA14750 was not amplified in all susceptible inbred lines, but it was also missing in the resistant high oleic restorer line RHA348 (Table 3 , Fig. 3) . RAPD marker OPAA111008 behaves in the same way as the derived SCAR marker SCAA111008. Both were not generated in the two resistant restorer lines RHA345 and RHA348 as well as in all susceptible lines. Marker OPAS12280, linked to the susceptibility allele of the Pl2 gene, differed from the expected absence/presence pattern in three cases (Table 3, Fig. 3).


View this table:
[in this window]
[in a new window]
  		Table 3 Correlation of the presence of markers OPAA14750, OPAC20831, OPAA111008, SCAA111008, and OPAS12280, with the presence of the sunflower resistance allele for downy mildew at locus Pl2

 


View larger version (103K):
[in this window]
[in a new window]
  		Fig. 3 Amplification of markers OPAA14750 (a) and OPAS12280 (b) in different resistant and susceptible sunflower germplasms. Lane 1, AS110; Lane 2, AS110Pl2; Lane 3, HA89; Lane 4, RHA325; Lane 5, RHA345; Lane 6, RHA348; Lane 7, CM587; Lane 8, CM592; Lane 9, CM596; Lane 10, CM610; Lane 11, HA291; Lane 12, HA323; Lane 13, HA342; Lane 14, HA350; Lane 15, HA850; Lane 16, HA-R2; Lane 17, CM591; Lane 18, CM594; Lane 19, CM603; Lane M, molecular weight marker (100-bp ladder, Gibco BRL). OPAA14750 and OPAS12280 are marked by arrows

 

   Discussion
TOP
 ABSTRACT
 INTRODUCTION
 Materials and methods
 Results
 Discussion
REFERENCES
 
Nine RAPD and two AFLP markers for the resistance locus Pl2 of sunflower were identified (Table 2, Fig. 1). This locus was originally discovered in the inbred line HA61 (Zimmer and Kinman, 1972) and is supposed to be very closely linked to the complex resistance locus Pl6 (providing resistance to all downy mildew races, so far) or to be a part of this complex locus (Vear et al., 1997). Therefore, markers for the Pl2 gene may be useful not only in selection for this locus itself (i.e., for pyramiding), but also for selection regarding the Pl6 gene.

The 11 markers cover 64 cM of this specific region of the sunflower genome. Eight of them are linked in coupling and three are linked in repulsion to the dominant Pl2 gene. The markers linked in the coupling phase include the most closely linked markers OPAA14750, OPAC20831, and E35M48-3 located within about 2 cM distance from the Pl2 locus. Since these three markers are linked in a distance less than 5 cM to the target gene, all three can be used for effective indirect selection (Weber and Wricke, 1994). The efficiency of the MAS can be increased by employing markers flanking the Pl2 locus (Weber and Wricke, 1994), e.g., OPAA14750 and OPB08730, even though OPB08730 is linked at 14.2 cM to the Pl2 gene. Although the most closely linked markers in repulsion phase, OPAS12280 and E41M62-2, are located about 11 cM distance to the Pl2 gene (pl2 allele), these markers may be useful for indirect selection in an F2 population. Markers linked to the susceptible allele of a resistance locus increase the selection efficiency, even at greater recombination frequencies between marker and resistance locus (Haley et al., 1994; Kelly and Miklas, 1998). The increased efficiency results from the ability to select against heterozygous genotypes, leading to an increased portion of selected homozygous resistant genotypes (Haley et al., 1994; Kelly and Miklas, 1998). The combination of repulsion and coupling phase markers for MAS can serve as quasi-codominant markers (Johnson et al., 1995; Kelly and Miklas, 1998).

In addition to close linkage, the predictability of molecular markers for MAS is determined by its applicability in different genetic backgrounds. Therefore, the most closely linked RAPD markers and SCAA111008 were screened with different susceptible and resistant sunflower inbreds. Different public inbred lines were chosen for their low degrees of relationship according to their pedigree data (Korell et al., 1992). This low degree of relationship was confirmed by RFLP analysis using simple sequence repeats (SSR) as hybridization probes (Korell et al., 1996b). Thus, these public inbreds can serve as a representative cross section of the various germplasms differing in resistance and susceptibility at the Pl2 locus.

The results (Table 3, Fig. 3) show very clearly the close correlation between linkage of the markers to the resistance locus and their ability to distinguish between the different susceptible and resistant inbred lines. Marker OPAC20831, which showed the closest linkage (about 2 cM distance) to the Pl2 locus together with OPAA14750 and the AFLP marker E35M48-3, differentiated perfectly between sunflower lines carrying the susceptible and resistant allele of the Pl2 gene (Korell et al., 1992). Correspondingly, OPAA14750 was not amplified in all susceptible germplasms. However, in contrast to OPAC20831 this marker was not present in the resistant restorer RHA348, which is a BC1F4 selection of the cross of restorer line RHA274 (Pl2) resistant to P. halstedii races 1, 2, 6, 7, and 9 with the cultivar Pervenets (Miller et al., 1987). In addition, RAPD marker OPAA111008 was absent in the restorer line RHA345, which shares its pedigree with RHA348 (BC1F4 selection of the cross RHA274*2/Pervenets). It was not generated in all susceptible inbreds. SCAA111008 showed the same presence–absence pattern as the original RAPD marker. In contrast to the expectation, OPAS12280 linked to the susceptible allele pl2 was not amplified in the susceptible maintainer line HA323 but in restorer lines RHA345 and RHA348 resistant to race 2 of downy mildew. Both markers, OPAA111008 (and correspondingly SCAA111008) and OPAS12280 are linked at 5.6 and 10.7 cM distance to the Pl2 gene, respectively. Hence, the recombination between the marker loci and the resistance gene in the three inbred lines is explained by the respective genetic distances of the marker to the Pl2 locus.

However, restorer line RHA348, which was described as resistant to race 2 of downy mildew (Miller et al., 1987) and should possess the resistance allele Pl2, was susceptible in a resistance test with field isolate GG-F5 (data not shown). The virulence pattern of this field collection is comparable to that of downy mildew races 7 and 9 (Table 1). The Pl2 gene is closely linked to the complex resistance locus Pl6, which consists of at least two very tightly linked genes (Vear et al., 1997). It was therefore concluded that the Pl2 locus may be a part of the Pl6 cluster including several closely linked genes. However, the Pl2 gene may also be a minor cluster including gene Pl1 conferring resistance to race 1 of P. halstedii (Vear et al., 1997). The presence of a Pl2 cluster including more than one gene would also explain the multiple resistances to downy mildew races 1, 2, 7, and 9 in the restorer line RHA325 and to races 1, 2, 6, 7, and 9 in the restorer line RHA274 formerly supposed to carry additional genes Pl9 and Pl10 (Gulya et al., 1991b), which could not be separated from the Pl2 locus yet (G. Seiler, 1997, personal communication). These conclusions indicate that restorer line RHA348 is the result of a recombination within the Pl2 cluster leading to a loss of resistance to downy mildew races 7 and 9, and the absence of markers OPAA14750 and OPAA111008/SCAA111008, while parts of the Pl2 locus conferring resistance to races 1 and 2, are still present.

We have developed markers that show a close linkage to the target gene and differentiate between a number of resistant and susceptible sunflower inbred lines. Hence, these markers are robust and useful for MAS regarding the Pl2 locus. In addition, they will be beneficial for the investigation of the genetics of different Pl resistance genes as was demonstrated elsewhere (Roeckel-Drevet et al., 1996; Vear et al., 1997). Since Pl2 and Pl6 are very closely linked (Vear et al., 1997), the Pl2 markers may also be useful in a MAS for the Pl6 cluster. Specifically, the use of allele specific markers like SCAR/STS will facilitate large scale marker analyses (Gu et al., 1995).Chunwongse Martin Tanksley 1993


   ACKNOWLEDGMENTS
 
We thank Dr. V.A. Vranceanu, Fundulea (Romania) for the donation of the near isogenic lines, and Prof. O. Spring for evaluating the virulence pattern of our downy mildew isolate GG-F5. For the Excel-macro which allowed us to draw the chromosomes, we thank Dr. Gunther Backes (TUM, Freising). Financial support by the Deutsche Forschungsgemeinschaft (DFG, Project-No. FR 682/6-2) and the Gesellschaft zur Förderung der privaten deutschen Pflanzenzüchtung (GFP, Project-No. ÖE 101/96 NR) is gratefully acknowledged.

Received for publication June 22, 1999.


   REFERENCES
TOP
 ABSTRACT
 INTRODUCTION
 Materials and methods
 Results
 Discussion
 REFERENCES
 




This article has been cited by other articles:


Home page
 Crop Sci.Home page
S. Tang, A. Heesacker, V. K. Kishore, A. Fernandez, E. S. Sadik, G. Cole, and S. J. Knapp
Genetic Mapping of the Or5 Gene for Resistance to Orobanche Race E in Sunflower
Crop Sci., May 1, 2003; 43(3): 1021 - 1028.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via ISI Web of Science (13)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Brahm, L.
Right arrow Articles by Friedt, W.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Brahm, L.
Right arrow Articles by Friedt, W.
Agricola
Right arrow Articles by Brahm, L.
Right arrow Articles by Friedt, W.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
The SCI Journals Agronomy Journal Vadose Zone Journal
Journal of Natural Resources
and Life Sciences Education		 Soil Science Society of America Journal
Journal of Plant Registrations Journal of
Environmental Quality		 The Plant Genome