Crop Science
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Published in Crop Sci 39:1715-1721 (1999)
© 1999 Crop Science Society of America
677 S. Segoe Rd., Madison, WI 53711 USA
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (24)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bligh, H.F.J.
Right arrow Articles by McClung, A.M.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Bligh, H.F.J.
Right arrow Articles by McClung, A.M.
Agricola
Right arrow Articles by Bligh, H.F.J.
Right arrow Articles by McClung, A.M.
Crop Science 39:1715-1721 (1999)
© 1999 Crop Science Society of America

CELL BIOLOGY & MOLECULAR GENETICS

Using Amplified Fragment Length Polymorphisms and Simple Sequence Length Polymorphisms to Identify Cultivars of Brown and White Milled Rice

H.F.J. Bligha, N.W. Blackhalla, K.J. Edwardsb and A.M. McClungc

a Division of Plant Science, School of Biological Science, University Park, University of Nottingham, NG7 2RD, UK
b IACR-Long Ashton Research Station, Department of Agricultural Sciences, University of Bristol, Bristol, BS18 9AF, UK
c USDA-ARS, 1509 Aggie Drive., Beaumont, TX 77713 USA

hfj.bligh{at}nottingham.ac.uk


    ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Increase in world rice consumption combined with the recent World Trade Organization General Agreement on Trade and Tariffs agreement on import tariffs have resulted in a need for a method to distinguish between white milled rice (Oryza sativa L.) cultivars sold at a premium from other milled cultivars. We have used two DNA-based methods, amplified fragment length polymorphisms (AFLPs) and simple sequence length polymorphisms (SSLPs), to distinguish six genetically related long-grain rice cultivars, and a premium Basmati cultivar. Of the two methods, AFLPs proved difficult to reproduce due to the quality of DNA that could be extracted from the samples, while SSLPs showed sufficient variation to distinguish all seven cultivars with only a small number of markers. Our study demonstrates that, using white milled grains, SSLPs are a more robust and efficient method than AFLPs for the identification of rice cultivars. We also report the development of six new SSLP primer sets.

Abbreviations: AFLP, amplified fragment length polymorphism • bp, base pairs • PCR, polymerase chain reaction • RAPD, randomly amplified polymorphic DNA • RM, rice marker • SSLP, simple sequence length polymorphism


    INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 Materials and methods
 Results
 Discussion
 REFERENCES
 
RICE IS THE PRIMARY

source of C for 57% of the world's population, and consumption in the western world is increasing, with consumption per capita in the USA doubling during the past decade (Rutger et al., 1998). With the increasing consumption in consumer markets such as the USA or Europe, prices of premium cultivars such as Basmati rice can be two to three times that of domestically grown rices (Khush and dela Cruz, 1998). This trend plus the increased international trade in rice as a result of the World Trade Organization General Agreement on Trade and Tariffs make methods for identifying premium brown and white milled rice a necessity (Juliano, 1998).

Cultivar identification methods based on DNA analysis, such as random amplified polymorphic DNA (RAPD) (Ko et al., 1994), SSLP (Panaud et al., 1996), and AFLP (Mackill et al., 1996), have been used for rice cultivars, with varying degrees of success. Only one of these methods, RAPD, has been tried using white milled rice as the starting material (Ohtsubo et al., 1997). While considerable work has been done using RAPD markers as a varietal-identification method in numerous species, primarily because of its simple and rapid nature, evidence suggests that it is not robust because of its sensitivity to changes in reaction conditions and DNA quality (Ellsworth et al., 1993; Muralidharan and Wakeland, 1993). As a result, this method is finding less favor now that more reliable methods are available. In comparison, AFLP and SSLP analysis are reliable methods that have been shown to work well with the rice genome, both in terms of reproducibility and the amount of polymorphism detected between cultivars (Akagi et al., 1996; Mackill et al., 1996; Panaud et al., 1996).

Amplified fragment length polymorphism is a DNA fingerprinting method that does not require prior knowledge of the DNA sequence to be analyzed (Vos et al., 1995), whereas SSLPs require a considerable effort to develop specific oligonucleotide primers for each locus of interest. However, once SSLP loci are defined, the protocol has the same simplicity of use as RAPD. Many reactions have to be performed to cover the entire genome, while one AFLP reaction can simultaneously identify multiple polymorphisms at various loci throughout the genome, depending on the amount of variation between the cultivars being studied. More than 100 SSLP loci have now been developed and mapped for rice (Akagi et al., 1996; Chen et al., 1997; Panaud et al., 1996), and many are now available commercially. Despite extensive evaluation of these methods on the rice genome using leaf tissue as starting material, the only method that has been evaluated using the milled or brown rice grain, the form which is traded on the open market, is RAPD (Ohtsubo et al., 1997). We were therefore interested in extending AFLP and SSLP analysis to DNA extracted from these forms of rice to assess their suitability for identification studies in analytical laboratories.

A previous study using AFLP and SSLPs on a series of closely related japonica cultivars of rice showed that both types of markers were suitable for detecting genetic variation between cultivars (Mackill et al., 1996), with both AFLP and SSLPs identifying a high level of polymorphism. Modern registered cultivars are assumed to be pure inbred lines according to the guidelines in "The Plant Variety Protection Act" of 1970 (U.S. Public Law 91-577) and as such, genetic markers should be useful in determining the identity of a cultivar. Moreover, registered cultivars have been found to have far less within-cultivar variation than the landraces (Olufowote et al., 1997), although some heterogeneity in registered cultivars has been found using DNA markers. It has been reported (Dilday, 1990) that the number of parental accessions used in the breeding of many of the currently released U.S. long-grain rice cultivars is very small, and for this reason, it is also important that any method used can readily detect variation between closely related cultivars. In comparison, Basmati cultivars are mainly purebred lines selected from cultivars of unknown parentage. These lines are currently being used in breeding programs, with agronomically superior cultivars, to improve factors such as yield, resulting in the production of new Basmati cultivars with features such as semidwarfism (Khush and dela Cruz, 1998). The ability to distinguish Basmati lines from other long-grain cultivars using white grain would also be of considerable benefit to Trading Standards Officers, in light of the considerable price premium of Basmati rice on the open market. Therefore, this study focused on groups of closely related cultivars, such as U.S. long-grains and Basmati, as well as cultivars grown in varying geographical locations. Using white milled and brown rice, we compare AFLP and SSLP analysis on a group of long-grain rice cultivars in order to determine whether these methods are suitable for analytical identification. Furthermore, we use SSLPs to phylogenetically group Basmati, and other long-grain cultivars, thus showing the distinct genetic profile of the majority of Basmati cultivars.


    Materials and methods
 TOP
 ABSTRACT
 INTRODUCTION
 Materials and methods
 Results
 Discussion
 REFERENCES
 
Plant Material
The initial cultivars chosen to assess the methodology were `Thaibonnet', a long-grain cultivar widely grown in Europe (Habida, 1987); `Doongara', an Australian long-grain cultivar (Ko et al., 1994); and four closely related U.S. premium long-grain rice cultivars, `Lemont' (Bollich et al., 1985), `Kaybonnet' (Gravois et al., 1995), `Cypress' (Linscombe et al., 1993), and `Jodon' (Linscombe et al., 1995) as examples of rice from divergent and similar geographical locations. A more divergent rice, `Basmati 370', originally released as a pure-line Basmati in 1930 in Punjab, and considered to be a definitive Basmati cultivar, was also chosen (Akram et al., 1997). Additional Basmati, Indian, and Pakistani long-grain cultivars supplied by the Ministry of Agricultiure Fisheries and Food (UK), and U.S. long-grain cultivars (see Fig. 1 a for list) were subsequently analyzed using only SSLP analysis.



View larger version (26K):
[in this window]
[in a new window]
 
Fig. 1 Phylogenetic analysis of 22 Basmati, U.S. long-grain, and non-U.S. long-grain cultivars (a) using all 29 SSLP markers, (b) using only eight of the SSLP markers, Waxy, M7, M16, M22, RM220, RM224, RM234, and RM55. Scale bars show genetic distance as calculated by the ({Delta}µ)2 method of Goldstein et al. (1995)

 
DNA Extraction
DNA was extracted from brown or white milled rice grain by grinding 1 g of rice grain to a fine powder using a mortar and pestle and then extracting the DNA from 0.2 g of the powder using a Phytopure DNA extraction kit (Nucleon Biosciences, Coatbridge, Scotland) according to the manufacturer's instructions. This method differs from most other published methods in that DNA is separated from other cell components using a patented polysaccharide binding resin combined with chloroform, that binds polysaccharides including starch, the major component of the rice grain. The final DNA pellet was dissolved in 120 µL of sterile water.

Amplified Fragment Length Polymorphism Analysis
The AFLP reactions were performed using the AFLP Analysis System I and AFLP starter primer kits (Life Technologies, Gaithersburg, MD) according to the manufacturer's instructions. The maximum volume of template DNA (18 µL) was used in all reactions. EcoRI primers (PE Applied Biosystems, Foster City, CA) with fluorescent label were used in the final amplification reaction containing 1 µL EcoRI primer and 4 µL MseI + dNTP mix. In some cases, where DNA amplification was not considered efficient due to poor quality of template DNA, the preamplification reactions were diluted 1:10 instead of 1:50 as suggested by the manufacturer, and 5 µL of this dilution used in the final amplification reaction. The AFLP reactions were resolved using an ABI 310 DNA sequencer (PE Applied Biosystems) in the Dept. of Immunology at the Queens Medical Centre, Nottingham,UK. Each reaction was run with a set of N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA) labeled size standards (PE Applied Biosystems). The results were analyzed using the GeneScan Analysis software (PE Applied Biosystems), which displays amplification products as peaks and determines the size of these products. The peaks from the seven samples were then aligned visually to define the polymorphic amplification products. Primers used were 6-carboxy-2',7'-dimethoxy-4',5'dichlorofluorescein (JOE) labeled EcoRI + AAG or 6-carboxyfluorescein (FAM) labeled EcoRI + ACT both in combination with MseI + CAA, MseI + CAC, MseI + CAG, MseI + CAT, MseI + CTA, MseI + CTC. MseI + CTG and MseI + CTT, giving a total of 16 different primer combinations.

Simple Sequence Length Polymorphism Analysis
Rice marker (RM) SSLP primer pairs (Research Genetics, Huntsville, AL) as described in Chen et al. (1997) and Panaud et al. (1996) were used. These included: RM1, RM4, RM9, RM11, RM13, RM16, RM19, RM26, RM55, RM168, RM201, RM202, RM208, RM212, RM219, RM220, RM222, RM223, RM224, RM225, RM229, RM231, RM234, RM247, RM253, and RM263. The previously reported Waxy SSLP marker linked to the Waxy gene on chromosome 6 was also used (Bligh et al., 1995). All amplifications were performed using an Omnigene Thermocycler (Hybaid, Hampton, Middlesex, UK) and Taq Supreme enzyme (Helena Bioscience, Sunderland, Tyne and Wear, UK). Reactions were cycled through 35 cycles of 94°C for 1 min, 55°C for 1 min, and 72°C for 1 min. Amplification products were visualized on either 2% agarose gels or 4% Metaphor (Flowgen, Lichfield, Staffordshire, UK) using ethidium bromide (BDH, Poole, Dorset, UK) gels.

Development of New Simple Sequence Length Polymorphism Primers
An enriched SSLP library was constructed as described previously (Edwards et al., 1996) using additional oligonucleotides at the enrichment step to those previously reported (see below for complete list of oligonucleotide sequences). This was to enable enrichment for additional triplet repeat sequences. DNA was isolated from 1 g of fresh leaf material (Lemont) as described above. Filters with bound oligonucleotide were prepared as previously described (Edwards et al., 1996). Oligonucleotide sequences used were as follows: {GA}15, {GC}15, {CAA}10, {CATA}10, {ATT}10, {GATA}10, {GCC}10, {CTG}10, {CAG}10, {CAT}10, {ACT}10, {GAC}10, and {AGA}10. Two hundred nanograms of genomic DNA were then digested (separately) with 3 µL of RsaI or SspI in a volume of 50 mL for 2 h at 37°C. Following digestion, 5 mL of 10 mM ATP, 1 mL of T4 ligase, and 1 µL (1 mg) of an MluI adapter (consisting of a 21 mer: 5'CTCTTGCTTACGCGTGGACTA3' and a 25 mer: 5'TAGTCCACGCGTAAGCAAGAGCACA3') were added. Ligation was then allowed to proceed for 2 h at 37°C. One microliter of the ligation mix was amplified in three separate reactions each containing 1 µL of ligation mix as template, 2 µL (200 ng) of 21 mer MluI adapter, 5 µL of 10X polymerase chain reaction (PCR) buffer, 8 µL of dNTPs (1.25 mM stock), and 0.4 µL Taq polymerase in 50 µL total volume. The reactions were subjected to 20 cycles of 95°C for 40 s, 60°C for 1 min, and 72°C for 3 min. Following PCR amplification, the various samples were pooled, phenol extracted, chloroform extracted, NaCl was added to 100 mM, and precipitated using 2.5 volumes of ethanol. Samples were kept on ice for 1 h and then centrifuged at 10000 g for 20 min. The samples were vacuum-dried and dissolved in 25 µL of fresh, sterile distilled water.

Enrichment for SSLPs was carried out combining all of the ligated denatured DNA in 500 µL of hybridization buffer containing 1 µg of the 21 mer oligonucleotide (5'CTCTTGCTTACGCGTGGACTA3') and a single Hybond N+ filter (Amersham Pharmacia Biotech, Arlington Heights, IL) with bound oligonucleotides. Hybridizations were allowed to proceed for 18 to 48 h at 50°C. Following hybridization, filters were washed five times (5 min per wash) in 2x SSC, 0.01% SDS at 65°C then 3x (5 min per wash) in 0.5x SSC, 0.01% SDS at 65°C (or both at 42°C if using an "AT" SSLP motif). Bound DNA was eluted in 200 µL of sterile distilled water by boiling for 5 min, NaCl was added to 100 mM. The DNA was then precipitated using 2.5 volumes of ethanol. Samples were kept on ice for 1 h and then centrifuged at 10000 g for 20 min. The samples were vacuum-dried and dissolved in 25 µL of fresh, sterile distilled water.

All of the enriched mix was digested with MluI in a total reaction volume of 75 µL at 37°C for 2 h. The digest was then applied to a Pharmacia S-300 spin column (Amersham Pharmacia Biotech), according to the manufacturer's instructions, to remove the restriction enzyme. The samples were then phenol extracted, chloroform extracted, NaCl added to 100 mM, and precipitated using 2.5 volumes of ethanol. Samples were incubated on ice for 1 h and then centrifuged at 10000 g for 20 min. The samples were vacuum-dried and dissolved in 25 µL of fresh sterile distilled H2O. Approximately 1 µL of the enriched DNA was ligated with 10 ng of a modified pUC 19 vector (pJV1) (Edwards et al., 1996), which contained a BssHII site in a 20-µL reaction incubated at room temperature for 16 h. MluI was included in the ligation to ensure that each plasmid contained only a single insert.

Two microliters of the ligation mix was transformed into DH10B (Life Technologies) cells as described previously (Edwards et al., 1996) and individual colonies selected and screened by PCR with M13 forward and reverse primers. Bands were visualized on 2% agarose gels and those greater than 250 base pairs (bp) were selected for direct DNA sequencing using M13 forward primer. These sequences were used to identify clones containing suitable simple sequence repeat motifs that were also sufficiently within the center of the insert to enable primers flanking the repeats to be designed. New primer sets were then used to screen the seven cultivars described above to assess polymorphism, using the same PCR conditions described above, except for primer set M12, which was amplified using an annealing temperature of 63°C instead of 55°C.

Phylogenetic Analysis
Data from all 29 SSLP sets were used for phylogenetic analysis to determine genetic relationships. Up to four alleles were identified for each primer pair and the repeat number for each was estimated using size markers on Metaphor gels or was calculated from sequencing data. This was then used to calculate ({delta}µ)2, an estimate of genetic distance for use with microsatellites as described by Goldstein et al., (1995). This is determined as

where µA and µB are the copy number (allele size) in Populations A and B, respectively. The actual calculations were performed using the Microsat v1.5 program (Minch et al., 1997) and the resulting table used in a neighbor joining program (Felsenstein, 1993) to generate a phylogram of genetic relationships.


    Results
 TOP
 ABSTRACT
 INTRODUCTION
 Materials and methods
 Results
 Discussion
 REFERENCES
 
All AFLP primer combinations were used initially on two cultivars, Jodon and Kaybonnet, to screen for number of amplification products (peaks), degree of polymorphism, and quality of AFLP products. Primers with three selective bases at each end were used, as previous reports had shown that while using only two selective bases gave a greater numbers of products in the reaction, the products were difficult to differentiate (Mackill et al., 1996). It was hoped that by using more selective primers, fewer amplification products with a greater level of amplification (giving increased peak height) would be obtained, improving scoring of polymorphisms. Primer sets that were judged to produce sufficient products and demonstrated polymorphism were then extended to the other cultivars. All seven cultivars were analyzed using seven primer combinations: EcoRI + AAG and Mse + CAA, EcoRI + AAG and MseI + CTT, EcoRI + AAG and Mse + CTC, EcoRI + AAG and Mse + CTA, EcoRI + AAG and Mse + CTG, EcoRI + ACT and Mse + CAC, EcoRI + ACT and Mse + CTG. Due to the quality of DNA extracted from the rice grain, very few products larger than 200 bp were obtained, and these were not reproducible between replicate reactions. As a consequence of this, analysis of polymorphic products was only performed on peaks sizing at between 50 and 200 bp. Peak heights, representing amount of amplified product, were also found to be not reproducible in reactions that produced a large number of products at a low level of amplification, thus giving a large number of small peaks. This made these peaks difficult to score for polymorphism, especially as these less well-amplified products were not always present in reactions performed on poorer quality DNA, (see above). No difference in AFLP quality was found between the brown or white milled samples. A typical AFLP chromatogram on two different DNA preparations of the same cultivar demonstrating differences between samples is shown in Fig. 2 . For the primer sets described, a total of 142 peaks, with a peak height of >10% of the highest peak on the original Jodon or Kaybonnet reaction, were counted. Of these, 31 were polymorphic among the seven cultivars. If Basmati 370, the most genetically distant cultivar is not considered, only 22 out of 142 amplification products were observed to be polymorphic among the six long-grain cultivars.



View larger version (37K):
[in this window]
[in a new window]
 
Fig. 2 Amplified fragment length polymorphism (AFLP) chromatogram showing runs of Jodon and Kaybonnet DNA using two independent DNA preparations run on different days using Mse + CAA and EcoRI + AAG primers. Chromatograms 1 and 3 = Jodon, Chromatograms 2 and 4 = Kaybonnet. Arrows indicate polymorphic peaks as follows: peaks that are polymorphic between the two cultivars consistently between duplicates (a); a peak that appears to be polymorphic between Jodon and Kaybonnet for Chromatograms 1 and 2, but the polymorphic peak is not present in the duplicate Jodon run on Chromatogram 3 (b); peaks of variable heights between the duplicate runs for Jodon (Chromatograms 1 and 3) (c)

 
In contrast, the SSLPs gave clear amplification products using either brown or white milled rice DNA. Of the original 27 primer sets used, ten were monomorphic for all seven cultivars on agarose gels (RM4, RM16, RM19, RM168, RM201, RM208, RM212, RM222, RM234, and RM253), ten were polymorphic for Basmati 370 while the other cultivars were monomorphic (RM1, RM9, RM11, RM13, RM26, RM202, RM220, RM225, RM229, and RM263), and four of the primer sets split the seven cultivars into two groups (RM219, RM223, RM231, and RM55). The three remaining sets used (RM224, RM247, and Waxy) gave three alleles within the seven cultivars (Table 1) . In one case, a marker, RM224, showed the presence of two bands, suggesting heterozygosity.


View this table:
[in this window]
[in a new window]
 
Table 1 Genotype of seven rice cultivars for polymorphic simple sequence length polymorphism (SSLP) markers. The number of repeats for each allele are shown. RM247 Doongara has two numbers as two bands were present, presumably because this cultivar is heterozygous at this locus

 
Given the comparative ease of use and reproducibility of SSLPs on DNA from white rice, it was decided to try to develop additional SSLP primer sets for use in cultivar identification. To this end, it was decided to construct an SSLP enriched library to screen for further potentially polymorphic repeat sequences. Triplet repeat sequences in particular have not been widely developed in rice, although these repeats have been shown to be highly polymorphic in other species. Fifty PCR clones were sequenced, of which 33 were unique sequences. Of these 33 sequences, 25 contained CGG or GCC repeat elements; however, these repeats tended to be seven copies or less, and those longer repeats for which primers were designed proved not to be polymorphic for the cultivars studied. However, use of these primers on a wider range of germplasm did result in some of them showing polymorphism, enabling them to be assigned map locations (McCouch and Temnykh, Cornell University, personal communication). As has been previously reported (Edwards et al., 1996), some clones were found to contain more than one repeat, and primers designed to amplify these sequences did produce polymorphisms, with three primer sets (M7, M12, and M22) each giving three alleles within the initial seven cultivars used in this study (Table 1). In addition, three other primer sets proved to be polymorphic for cultivars not covered by this study (see Table 2) . All six primer sets have been mapped (McCouch and Temnykh, 1998, personal communication) and chromosome locations determined (Table 2).


View this table:
[in this window]
[in a new window]
 
Table 2 New simple sequence length polymorphism (SSLP) primer sets developed during the course of this work. Repeat numbers are given for Lemont, the cultivar used to construct the SSLP enriched library

 
Analysis of rice cultivars using SSLP was then further extended to include a selection of Basmati and other long-grain cultivars. In particular, it was of interest to see whether Basmati varieties (Group V by isozyme classification of Glaszmann, 1987) could be distinguished from the other varieties used in the study. The cultivars were screened with 29 SSLP primer sets (sets RM253, M10, M12, and M26 were not used because of poor amplification of some samples). Most of the cultivars studied (see Fig. 1) could be separated by only eight different primer sets: Waxy, M7, M16, M22, RM220, RM224, RM234, and RM55. However, in many cases, only one polymorphism was detected between Basmati cultivars. For example, RM220 was the only polymorphic marker between Dehradun Basmati and Basmati 370, while Tarori, Line 4048, and Basmati Pakistan could not be distinguished by any of the 29 primer sets. In contrast, Pusa Basmati 1, a cultivar that was released as recently as 1995 by the Indian Agricultural Research Institute, showed considerable divergence from other older cultivars that were produced through pure-line selection. RM201 and RM222 were the only markers to show polymorphism only between the two non-U.S. long-grain cultivars, Terricot and IR6, and the remaining cultivars. However, 11 primer sets gave polymorphism within the Basmati cultivars once Pusa Basmati 1 was removed from the group. For all 22 cultivars, very little heterozygosity was observed, with five cultivars — Doongara, Pusa Basmati 1, Texmati, IR6, and Drew — all showing heterozygosity at one locus and one cultivar, Kasmati, showing heterozygosity at two loci.

Phylogenetic analysis of these cultivars was performed for all 29 alleles (Fig. 1a) and then for eight alleles only (Fig. 1b), the minimum number of alleles that could be used to separate all 22 cultivars, with the exception of the three cultivars that could not be separated at all. In both cases, IR6 was used as the outgroup, as it is neither U.S. long-grain or Basmati. Analysis with all 29 SSLPs placed the Basmatis in a single cluster, with the U.S. long-grains, including Kasmati and Texmati, all forming a second cluster away from the non-U.S. long-grains. However, similar analysis using only eight markers, while still separating all the cultivars, gave a more complex tree with fewer obvious clusters and no obvious clustering of either Basmati or U.S. long-grain cultivars.


    Discussion
 TOP
 ABSTRACT
 INTRODUCTION
 Materials and methods
 Results
 Discussion
 REFERENCES
 
DNA extracted from white milled rice was found to be usable in both AFLP and SSLP reactions, although the yield was low and in some cases, normal dilutions could not be used for the AFLP reactions. Despite this, the method used was found to be superior than that used previously on rice grain (Bligh et al., 1995) in that the Phytopure gave more reliable results with the SSLP primer amplification. The previously used method did not result in DNA capable of complete restriction digestion (Bligh, 1997, unpublished data), a prerequisite for the AFLP analysis, possibly as a result of polysaccharide, specifically starch contamination, which is a common problem with DNA extraction from plant material with high starch content. While the method of DNA extraction used here did allow AFLP reactions to be performed, the peak heights between reactions on individual DNA preparations from the same cultivar for the AFLPs presented here (Fig. 2) were variable. This suggests that the quality of DNA produced using the Phytopure method, in terms of length of DNA fragments, was variable. This was most likely due to the small amount of DNA left in white milled rice, as most of the DNA is contained in the bran layer and embryo, which are stripped away in milling, although there seemed to be little difference between the quality of DNA extracted from white and brown rice grains. In addition, shearing may have occurred, at least in part, during the milling process, and further degradation of the DNA could also have occurred during the desiccation process and storage, as these were mature grains.

For the AFLP analysis, this also resulted in amplification products with a molecular weight of >200 bp being very unreliable for scoring, in contrast to previous studies of AFLP on rice, which used DNA from fresh leaf tissue and gave reliably scored bands of up to 500 bp (Mackill et al., 1996). The number of polymorphic bands in a single reaction ranged from six to two, with only two of the seven primer sets able to distinguish all seven cultivars. To distinguish a cultivar from a larger pool of possible cultivars would therefore take at the very minimum at least two and probably more reactions.

In contrast, the SSLP amplifications were found to be reliable, as the majority of products were under 200 bp. SSLP alleles could, in many cases, also be distinguished on 2% agarose gels, which also reduces the time and cost of analysis.

One problem with both methods is that for many of the markers chosen, there was very little polymorphism. This is probably primarily due to the that fact four of the seven cultivars (Jodon, Kaybonnet, Lemont, and Cypress) selected are closely related (Ayres et al., 1997; Dilday, 1990), with Doongara (Calrose, Bluebelle, and Jojutla; Ko et al., 1994) and Thaibonnet having parentage from within the U.S. germplasm. Development of markers to distinguish such closely related cultivars such as Doongara, which is grown in Australia, and Cypress, a U.S. grown cultivar, is of interest to commercial suppliers to distinguish home-grown rice from imported shipments.

Although only three new SSLP alleles that were polymorphic within this group were developed from the SSLP enriched library used in this study, all three were found to have multiple alleles that were detectable on 2% agarose gels within the seven test samples. This demonstrated that use of carefully chosen SSLP markers can result in needing only a small number to distinguish a cultivar. The seven cultivars in this study were all distinguishable using only three markers, M22, M7, and Waxy.

Screening the SSLP enriched library by PCR proved to be a useful method for selecting suitable clones for sequencing, as a large number of the PCR products were 250 bp or less, which meant that, as {approx}100 bp of this was vector sequence, there was unlikely to be sufficient sequence either side of any repeat in the clone to enable primer design.

The low number of polymorphic SSLPs isolated from our library is probably due to the high proportion of short CGG/GCC SSLPs it contained, with the longest sequence having only nine repeats. This is in agreement with previous studies (Innan et al., 1997; Goldstein and Clark, 1995), noting a positive correlation between length of repeat motif and allelic variation. In these studies, it has been noticed that repeat sequences with less than 10 repeat units are less likely to be polymorphic. In plants, the average number of CGG/GCC repeats in SSLPs has been found to be only ten (Edwards et al., 1996), and for rice, it would appear to be lower, with the majority of our sequences having seven or less repeats. This is probably partly due to the fact that many CGG/GCC repeats have previously been found to be in expressed sequence tag (EST ) sequences (Akagi et al., 1996), and are part of the coding region of genes. The high incidence of CGG/GCC repeats is possibly a feature of the rice genome. For example, a screen of the DDJB DNA sequence database showed that there were twice as many CGG/GCC SSLPs than there were of the next most frequent repeat (Akagi et al., 1996), although these have proved difficult to isolate using poly (CCG) hybridization from DNA libraries (Panaud et al., 1996). In addition, the average insert size in this library (inserts were nearly all smaller than 450 bp) contributed to there being very few usable sequences because many had repeats too near to one end of the sequence to enable primer design. It is unlikely that the high incidence of CGG/GCC repeats found in this library is due solely to the method of screening because libraries from other species made at the same time were found to have a reasonable distribution of triplet repeats (Edwards, 1997, unpublished data).

The phylogenetic analysis, while giving very little information when using data from only eight SSLP markers, showed clear differentiation of groups of cultivars when all 29 markers were used. The isozyme study of Glaszmann (1985) predicts that the Basmati cultivars (Group V) and the U.S. long-grain cultivars (Group VI) would segregate separately, with the Group I IR6 and Terricot forming a third group, and this is observed. The close relationship between some of the Basmati cultivars tested (in particular Tarori, Line 4048 and Basmati Pakistan) suggests that these cultivars, produced by single line selection, have all come from within a single population, which is hardly surprising given their geographical origin. It is interesting to note that Pusa Basmati 1, the product of a cross between Pusa 150 (a Group I indica) and Karnal Local (a Group V Basmati), which might have been expected to segregate away from the other Basmati cultivars, actually segregates with the seven other Basmati cultivars, although it does appear less genetically related.

In contrast, Texmati and Kasmati, which are also products of crosses between long-grain semidwarf cultivars and authentic Basmati cultivars (Sarreal et al., 1997), both segregate with the U.S. long-grains, although Texmati, which has been reported to have less aroma and grain elongation than typical Basmati cultivars from India or Pakistan (Sarreal et al., 1997), segregates closer to the U.S. long-grains than Kasmati.

In conclusion, although AFLP analysis will allow differentiation of cultivars, the amount of variation in a single reaction is such that multiple reactions would need to be done to be certain that a cultivar had been correctly identified, making this method less preferable than the SSLP method. Because of the existence of a large number of commercially available primers sets, SSLPs have the advantage of being easier to perform, as well as being cheaper, faster, and considerably more robust with regard to the quality of DNA needed for successful application. We would therefore recommend SSLP as the method of choice for identification of white milled rice.


    ACKNOWLEDGMENTS
 
The authors would like to thank Dr. Paddy Tighe and Miss Sue Stevens for running the ABI 310 sequencer, Prof. Susan McCouch for critically reviewing the manuscript, Dr. Svetlana Temnykh for mapping the SSLP primers and Prof E.C Cocking for helpful discussions. This work was funded by the UK Ministry of Agriculture Fisheries and Food.

Received for publication February 23, 1999.


    REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 Materials and methods
 Results
 Discussion
 REFERENCES
 




This article has been cited by other articles:


Home page
Crop Sci.Home page
M. Rahman, D. Hussain, and Y. Zafar
Estimation of Genetic Divergence among Elite Cotton Cultivars-Genotypes by DNA Fingerprinting Technology
Crop Sci., November 1, 2002; 42(6): 2137 - 2144.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (24)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bligh, H.F.J.
Right arrow Articles by McClung, A.M.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Bligh, H.F.J.
Right arrow Articles by McClung, A.M.
Agricola
Right arrow Articles by Bligh, H.F.J.
Right arrow Articles by McClung, A.M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
The SCI Journals Agronomy Journal Vadose Zone Journal
Journal of Natural Resources
and Life Sciences Education
Soil Science Society of America Journal
Journal of Plant Registrations Journal of
Environmental Quality
The Plant Genome