Crop Science Journal of Natural Resources and Life Sciences Education
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Published in Crop Sci 39:1696-1701 (1999)
© 1999 Crop Science Society of America
677 S. Segoe Rd., Madison, WI 53711 USA
This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via ISI Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jain, R. K.
Right arrow Articles by Coffey, M.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Jain, R. K.
Right arrow Articles by Coffey, M.
Agricola
Right arrow Articles by Jain, R. K.
Right arrow Articles by Coffey, M.
Crop Science 39:1696-1701 (1999)
© 1999 Crop Science Society of America

CELL BIOLOGY & MOLECULAR GENETICS

Isolation and Characterization of Two Promoters from Linseed for Genetic Engineering

Ravinder K. Jaina, R.Gail Thompsonb, David C. Taylora, Samuel L. MacKenziea, Alan McHughenb, Gordon G. Rowlandb, Don Tenaschuka and Maxine Coffeya

a National Research Council of Canada, Plant Biotechnology Institute, Saskatoon, SK, Canada S7N 0W9
b Crop Development Centre, Univ. of Saskatchewan, Saskatoon, SK, Canada S7N 5A8

jravinder{at}pbi.nrc.ca


   ABSTRACT
TOP
 NOTES
 ABSTRACT
INTRODUCTION
 Materials and methods
 Results and discussion
 REFERENCES
 
Linseed (Linum usitatissimum L.) is an important oilseed crop worldwide and is cultivated for the high level of linolenic acid (18:3) in its seed oil. Currently, there is a concerted effort to improve linseed by genetic engineering. This will require appropriate transgenes and tissue-specific or constitutive promoters. We report the isolation and characterization of two linseed promoters from a two-member gene family encoding the enzyme stearoyl-acyl carrier protein desaturase (SAD). The SAD1 and SAD2 gene promoter were each fused transcriptionally with the reporter gene for ß-glucuronidase (uidA; GUS) and were transferred to linseed to study their expression pattern. In transgenic linseed, GUS activity mediated by the SAD2 promoter appeared to be constitutive and was detected in leaves, apices, stem, roots, flower buds, flowers, and seeds. In contrast, GUS activity mediated by the SAD1 promoter appeared to be root- and seed-specific. In developing seeds, both the promoters exhibited a temporal expression pattern concomitant with protein and lipid biosyntheses. The GUS activity could be detected as early as 4 days after pollination (dap) and in mature seeds (~50 dap) with the highest activities around mid-development. The first pair of linseed promoters will be useful for manipulating the expression of indigenous as well as transgenes in linseed to create value-added cultivars.

Abbreviations: dap, days after pollination • OLs, oligoribonucleotides • SAD, stearoyl-acyl carrier protein desaturase • uidA, ß-glucuronidase


   INTRODUCTION
TOP
 NOTES
 ABSTRACT
 INTRODUCTION
Materials and methods
 Results and discussion
 REFERENCES
 
LINSEED is the third most important oilseed crop in Canada and an important crop worldwide. It is grown for the high linolenic acid (18:3) content in its seed oil. There is a concerted effort by several laboratories to diversify linseed as a crop by molecular genetic manipulation. For example, there is a need for creating new linseed cultivars with a wider range of fatty acid composition to supplement the existing food and confections markets [17]. Also, there is commercial interest in the use of linseed as a vehicle for biofarming of pharmaceutically related products because of its self-pollinating nature [13]. A need for linseed varieties tolerant to various abiotic and biotic stresses has also been recognized [17]. A number of herbicide-tolerant linseed varieties that are useful in crop rotation programs are becoming available [17].

Molecular genetic manipulation of linseed can be achieved by expressing appropriate transgenes by means of tissue-specific or constitutive gene promoters. A limited number of promoters have been used in linseed to introduce novel characteristics. Whereas the constitutive promoters such the CaMV 35S and nos gene promoters have been shown to function in linseed [10], the seed specific napin promoter is not effective [14]. Moreover, these promoters are protected by intellectual property laws, which cause unnecessary delays in reaching licensing agreements before the promoters can be used in a breeding program. We, therefore, set out to identify promoters from linseed that can be utilized in our breeding programs.

In linseed, SAD ({Delta}9-18:0-ACP desaturase; EC 1.14.99.6) activity can be detected from about 10 dap to seed maturity (R. Jain et al., 1996, unpublished), suggesting that the promoter of this gene would be useful in manipulating gene expression during seed development. SAD is a soluble enzyme that catalyzes conversion of stearoyl-ACP (18:0-ACP) to oleoyl-ACP (18:1{Delta}9-ACP) by introducing a double bond at the carbon 9 position [16]. Although SAD was one of the first enzymes in the fatty acid biosynthetic pathway to be purified [11], the cDNA for this enzyme was reported only in 1991 [20, 24]. Since then cDNA clones for SADs from several plant species including linseed have been isolated and characterized [see 26 for references]. The crystal structure of a castor SAD has recently been resolved, and structure and function studies have been conducted [3]. Since SAD is an essential enzyme in producing unsaturated fatty acids, it has been used to manipulate the levels of saturated and unsaturated fatty acids in both structural and storage lipids by genetic engineering [6,8]. Despite progress in defining the structure and function of SAD, the promoters of its gene are not well characterized. There is only one report of characterization of a SAD gene promoter from rapeseed (Brassica napus L.) [22]. Slocombe et al. [22] characterized the regulation of a promoter from one of the four SAD genes of rapeseed in tobacco (Nicotiana tabacum L.). The Bn 10 promoter was active in oleogenic tissues such as embryo and pollen grains, and in rapidly growing tissues such as immature flowers and seedlings. This is likely due to a higher requirement for SAD during the period of lipid biosynthesis in these tissues.

We report the isolation and characterization of the two linseed promoters from a two-member SAD gene family. We studied the expression of the reporter gene uidA under the control of the two promoters in transgenic linseed and report the findings here.


   Materials and methods
TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 Materials and methods
Results and discussion
 REFERENCES
 
Molecular Biological Techniques
Isolation of plasmid DNA, restriction digestion, modification and ligation of DNA, PCR, gel electrophoresis, and transformation and culture of E. coli strains were performed according to standard procedures [19]. Nucleotide sequencing was performed with double stranded plasmid DNA by the dideoxy chain termination method [18] with the Taq dyedeoxy terminator cycle sequencing kit and an Applied Biosystems Model 370A Sequencer (Perkin-Elmer, Foster City, CA). The OLs used in nucleotide sequencing and PCR techniques were synthesised by a phosphoramidite synthesis procedure in a Biosearch 8750 DNA synthesizer (New Brunswick Scientific Co., Edison, NJ) and purified by HPLC-based protocols.

Plant DNA was extracted according to the protocol of Dellaporta et al. [5] except that RNA was removed by adding 100 µg of RNase B (Sigma, St. Louis) followed by incubation at 65°C for 20 min. The DNA was extracted once with an equal volume of phenol:chloroform (1:1, v/v) and once with an equal volume of chloroform:isoamyl alcohol (24:1, v/v). Five micrograms of DNA were digested with the appropriate restriction enzyme, fractionated on a 0.8% (w/v) agarose gel, and pressure-blotted onto Hybond-N nylon membranes (Amersham Pharmacia Biotech, Inc., Baie d'Urfé, Québec) with the PosiBlot apparatus (Stratagene, La Jolla, CA) after depurination, denaturation and neutralization of the DNA [19]. The blotting solution contained 0.02 M NaOH and 1 M ammonium acetate. The DNA was immobilized on the membrane by baking the membrane at 80°C for 1 h.

Radioactive probe fragments for identifying promoters spanned 75 bp in the 5' end region of the SAD cDNA and were prepared by annealing 10 ng of OL29A and OL30A [OL-29A(+): 5'-120CCTTCAACAACAATGGCTCTCAAGCTCAACCCAGTCACCACCTT-3'; and OL-30A(-): 5'-194GGAGAAGTTGTTGAGGGAGCGTGTTGAAGGGAAGGT GG TGACTGGGTTGA-3'. The number in subscript corresponds to the nucleotide residue in the SAD cDNA sequence [21] and + or - indicates a coding or a non-coding strand]. The ends of the annealed OLs were filled-in by means of the Klenow fragment of DNA polymerase and random primer kit solutions (Life Technologies, Inc., Rockville, MD). Prehybridization was done at 65°C for 3 h in 5x SSPE (1x SSPE is 0.18 M NaCl, 10 mM Na PO4, and 1 mM EDTA [pH 7.7]), 5x Denhardt's solution (1 mg/mL ficol, PVP, and BSA), 0.5% (w/v) SDS, and 500 µg of salmon sperm DNA (Amersham). Hybridization was done at 55°C for 18 h. The membrane was washed at room temperature in 2x SSPE and 0.1% SDS for 15 and 5 min and then at 50°C in 1x SSPE and 0.1% (w/v) SDS for 10 min. At this point, the membrane was free of background signal. Autoradiograms were obtained by exposing the DNA on the membrane to Kodak X-OMAT AR films with intensifying screens at -70°C.

IPCR was done according to Ochman et al. [15] and Warner et al. [25]. Briefly, the linseed genomic DNA was digested with SstI and the fragments were separated on an agarose gel. The agarose pieces containing the putative promoter fragments were cut out from the gel. The DNA was eluted and ligated at a concentration of 1 ng µL-1 to form single circular DNA molecules. Five nanograms of the circularized DNA and 100 ng of the primers OL39 (-): 5'- 253TTGGTGGAGGT GGAACTGAA-3' and OL110 (+): 5'-263AGCTAAAGA AGTCACATGGAC-3' were used in a 50-µL PCR reaction. The PCR was hot-started at 95°C for 10 min. A single PCR cycle consisted of a denaturation step at 92°C for 1.5 min, an annealing step at 55°C for 2 min, and an extension step at 72°C for 2 min. After 35 cycles, products were completely extended at 72°C for 10 min.

A 1.76-kb DNA fragment containing only the 5' regulatory region and a part of the untranslated region of the SAD1 gene was amplified by PCR and cloned into the pCRII vector (Invitrogen Corp., Carlsbad, CA). The same fragment was retrieved as an EcoRI fragment from the pCRII vector and cloned into pBluescript II SK (Stratagene) to gain some cloning sites. The relevant 5' regulatory region, about 1.27 kb, of the SAD2 gene was also PCR amplified and cloned into the EcoRV site of pBluescript II SK vector. The 5' regulatory elements of the SAD1 and SAD2 genes were then cloned into pRD420 [4] as SalI-SmaI fragments in front of the uidA gene. The resulting SAD1 and SAD2 constructs were labeled as pCDC214 and pCDC220, respectively, and transferred directly into Agrobacterium tumefaciens strain GV3101 containing helper plasmid pMP90 [9] by a freeze-thaw method of transformation [1].

Linseed Transformation
Seeds were surface sterilized by stirring in 70% (v/v) ethanol for 2 min, followed by three 10-min washes in 0.5% (v/v) sodium hypochlorite, and 5 rinses in sterile distilled water. Seeds were germinated in the dark at 22°C for 5 to 7 d on basal medium consisting of MS major and minor salts and Gamborg vitamins (Sigma), 3% (w/v) sucrose and 0.8% (w/v) agar, pH 5. Derivatives of A. tumefaciens strain GV3101/pMP90 carrying pCDC214 and pCDC220 were grown in 10 mL liquid 2x YT medium [19] supplemented with 50 µg/mL kanamycin, 50 µg/mL gentamycin sulfate, and 20 µM acetosyringone. Cultures were grown at 28°C with rotary agitation for about 24 h. Prior to inoculation of linseed tissues, the cell concentration of the suspension was adjusted to 1 x 109 cells/mL. Transformed callus was obtained by the method of Mlynárová et al. [12] with the following modifications: hypocotyl segments were inoculated with Agrobacterium for 30 min, maltose (3%, w/v) replaced sucrose as the carbohydrate source in the MSD4x2 medium [2], and the selection medium contained 100 µg/mL kanamycin. Green callus formed at the cut ends of the inoculated hypocotyl segments was excised and transferred to basal medium (3% maltose) supplemented with 5 µM zeatin, 100 µg/mL kanamycin, and 200 µg/mL cefotaxime. Shoots regenerated from some of the calli within 3 to 4 wk. The shoots (0.5–1.0 cm long) were removed and placed in rooting medium: 0.5 strength MS salts, 3% (w/v) sucrose, 0.1 µM indole acetic acid, 0.8% (w/v) agar, pH 5.8, and 30 µg/mL kanamycin to select transformed shoots. The shoots were maintained under low light (<25 µmol m-2 s-1) for 6 to 8 d by which time some of the shoots had roots about 2 to 3 mm long. The plantlets were transferred to pots in the growth chamber within 10 to 14 d, when roots were about 2 cm long and the shoots were 3 to 5 cm tall. Transgenic plants were grown under 18 h of light (300–500 µmol m-2 s-1) and day/night temperature of 20/17°C. The plants were fertilized just before flowering with a solution containing 27 g of 15N: 30P: 15K supplemented with 0.9 g CuSO4 in 9 L of water. The transformation frequency of linseed was found to be low and only a few plants could be obtained with each construct. We analyzed the tissues from two independent plants or from two progeny to make sure the observed differences in activity were consistent. Primary transformants of linseed were identified by PCR.

Tissue Sampling and Fluorimetric GUS Enzyme Assay
Various tissues during plant development and developing seeds at different stages were harvested and immediately frozen in liquid N2 and stored at -80°C until analyzed. Fluorimetric GUS assays were done essentially according to Jefferson [7]. The assays were done in a micro well titer plate and fluorescence of the reactions was measured with a CytoFluor II multi-well fluorescence plate reader (PerSeptive Biosystems, Inc., Farmingham, MA).

Determination of Fatty Acid and Protein Content
The fatty acid content of seeds at different developmental stages was determined by fatty acid methyl ester analysis of seed homogenates as described previously [23]. The same protein extracts that were used for GUS assays were used for protein estimation. Protein concentrations were determined by a modified Bradford assay method (Bio-Rad protein assay; BIO-RAD, Richmond, CA) and BSA as the standard.


   Results and discussion
TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 Materials and methods
 Results and discussion
REFERENCES
 
Identification, Isolation, and Characterization of the SAD Gene Promoters
Only one SAD gene has been identified in linseed previously [21, S. Singh, 1993, pers. comm.]. However, we found two SAD genes in linseed when we tried PCR on linseed genomic DNA (R. Jain et al., EMBL Accession no. AJ006957 and AJ006958). Both genes had three exons and two introns (Fig. 1a) . Since both genes encoded an open reading frame of 1191 bp like the cDNA, we surmised that both genes might be transcriptionally active. The promoters of the two genes were isolated by employing a combination of DNA blot and IPCR techniques. The genomic DNA was digested with BamHI, BclI, BglII, NdeI, or SstI. These restriction enzymes would cut within the SAD genomic sequence as indicated and elsewhere in the genome (Fig. 1a). When the DNA blot was hybridized with a probe spanning a part of the 5' end of the cDNA, two different size fragments hybridized with the probe, indicating the existence of two SAD genes in linseed. The two DNA fragments contained the 5' upstream region and a part of the 5' untranslated and coding region of the SAD genes (Fig. 1). The smear in the high molecular weight range in Fig. 1 is likely due to partial digestion of the DNA.



View larger version (55K):
[in this window]
[in a new window]
  		Fig. 1 Partial restriction map of the SAD1 gene (a) and identification of SAD1 and SAD2 genes and their promoters by DNA blot analysis (b). E, exon; I, intron; and UT, untranslated regions

 
The two fragments obtained from the digestion of DNA with SstI would contain about 1.7 and 1.2 kb of the promoter regions of the SAD1 and SAD2 gene, respectively (Fig. 1 and 2) . DNA fragments were isolated from a region of the preparative agarose gel where the DNA fragments that hybridized with the SAD probe were expected to be present (Fig. 1) and used as templates in IPCR. Two distinct fragments of the expected sizes, 2.2 and 1.7 kb, were amplified. The untranslated region and parts of exon 1 and exon 2 which also amplified during IPCR constituted the additional 0.5 kb.



View larger version (44K):
[in this window]
[in a new window]
  		Fig. 2 Nucleotide sequence of the 5' regulatory regions of the two SAD genes. Homologous nucleotides (nt) are represented by a dash (-), gaps by a dot (.), and additions by lower case letters. A putative transcriptional site is indicated by +1, and a TATA box is overlined. Key restriction sites are also shown

 
The two DNA fragments containing the 5' regulatory regions of the two genes were cloned and sequenced (Fig. 2; EMBL Accession no. AJ006955 and AJ006956). On the basis of the sequence data we matched the 3' regions of these DNA fragments with the 5' coding regions of the two SAD genes, and thereby assigned the promoters to their respective SAD genes. There are a few short deletions, some substitutions and minor gaps in the two promoters. In the SAD2 gene promoter, 368 bp corresponding to nucleotides 759 to 391 in the SAD1 gene promoter were also absent.

Expression of a Reporter Gene by SAD Gene Promoters in Transgenic Linseed
In transgenic linseed, uidA expression, measured as GUS activity, mediated by the SAD2 promoter was detected in young leaves and apices, mature leaves, stems, roots, flower buds, flowers, and seeds (Fig. 3) . In flowers, GUS activity was restricted to the apical half of sepals, the vasculature of petals, the anther sac and pollen grains of the androecium, and the stigma and style of the gynoecium (histochemical data not shown). These observations are consistent with the results of expression of a rapeseed SAD gene promoter in tobacco [22]. In contrast, the SAD1 promoter was weaker, and little or no activity was detected in tissues other than roots and seeds. In developing seeds, however, both promoters showed a similar temporal expression pattern (Fig. 4) . The GUS activity could be detected as early as 4 dap and in mature seeds (~50 dap) with the highest activities around mid-development (14–28 dap). In seeds, GUS activity was mostly confined to the embryos and could be detected at the early heart stage. Thereafter, GUS activity could be seen in embryos of all subsequent stages, including the mature embryos in desiccated seeds.



View larger version (28K):
[in this window]
[in a new window]
  		Fig. 3 Expression of a heterologous gene, uidA, by the two SAD gene promoters in various tissues of linseed. Different tissues are abbreviated as YL+A, young leaves and apices; ML, mature leaves; S, stems; R, roots; B, buds; 1/2 OF, half open flowers; Fl, fully open flowers; and MS, seeds at about mid-development. The data presented are means of assays conducted on T1 progeny of two plants transformed with a tandem 35S promoter (2x35S) construct, T1 and T3 progeny of two plants transformed with pCDC214 (SAD1) construct, and T1 progeny of two plants transformed with pCDC220 (SAD2) construct

 


View larger version (13K):
[in this window]
[in a new window]
  		Fig. 4 Expression of a heterologous gene, uidA, by the two SAD gene promoters during linseed seed development and in relation to fatty acid and protein biosyntheses. For GUS assays, the data represent means of assays done on T1 progeny of two plants transformed with a tandem 35S promoter (2x35S) construct, T1 and T3 progeny of two plants transformed with pCDC214 (SAD1) construct, and T1 and T3 progeny of a plant transformed with pCDC220 (SAD2) construct. For fatty acids, three individual embryos of linseed cv. McGregor were analyzed at various stages. For protein content, data are means of estimations done on two transgenic plants transformed with pCDC214 and 220

 
In transgenic linseed, the SAD2 gene promoter was active in various vegetative and reproductive tissues to the extent that it can be characterized as constitutive. This is consistent with the requirement for desaturase gene activity in all tissues, particularly in young and actively growing tissues and in the storage organ, the seed [22]. This raises the possibility of using native SAD gene promoters to manipulate constitutive gene expression in plant species. In contrast, the SAD1 promoter was considerably weaker and appeared to be root- and seed-specific. The 368-bp deletion in the SAD2 gene promoter could be interesting in this regard. The corresponding region in the SAD1 gene promoter might contain negative regulatory elements responsible for the quantitative differences in the activity of the two promoters. In addition, it might contain elements that determine the tissue specificity of the SAD1 gene promoter. These issues can be resolved by conducting deletion or substitution analyses of the 368-bp region in SAD1 or SAD2 gene promoters, respectively. During seed development, uidA gene expression by the SAD1 and SAD2 promoters correlated well with both lipid and protein biosyntheses and the maximum activity of these promoters precedes the peak accumulation of fatty acids and proteins (Fig. 4). Both promoters will therefore be useful in modifying lipid and protein characteristics of seed. The two promoters can also be used to control constitutive or tissue-specific expression of other transgenes in linseed. For example, the SAD2 gene promoter could be used to drive the expression of several herbicide and other stress resistance genes constitutively to create enhanced germplasm [17], whereas the SAD1 gene promoter could be used to increase levels of, e.g., stearic acid in seed to create a cocoa butter type oil by expressing an antisense SAD gene, since the constitutive antisense expression of a SAD gene has proven to be lethal [14].

The SAD2 gene promoter appeared to be as good as or even better than the tandem 35S CaMV promoter in some tissues of transgenic linseed (Fig. 3 and 4). The SAD2 promoter was also stronger than the SAD1 promoter in transgenic linseed. The strong constitutive expression by the SAD2 gene promoter prompted us to evaluate it in other crops to broaden its utility. Unfortunately, it was quite weak in transgenic lines of tobacco and rapeseed (R. Jain et al., 1997, unpublished). It was also weak in pea (Pisum sativa L.) as determined by transient gene activity in pea embryonic axes and cotyledons that were bombarded with the reporter constructs by a particle gun [J. Mahon, M. Anderson, R. Jain, and S.L. MacKenzie, 1997, unpublished]. This suggests that the two promoters are regulated differently in these diverse plant species and are linseed specific. We anticipate isolation and characterization of the first pair of promoters from linseed will facilitate expression of indigenous as well as transgenes in linseed to create value-added cultivars.1; 2; 3; 4; 5; 6; 7; 8; 9; 10; 11; 12; 13; 14; 15; 16; 17; 18; 19; 20; 21; 22; 23; 24; 25; 26


   ACKNOWLEDGMENTS
 
We thank B. Panchuck for DNA sequencing, D. Schwab for oligonucleotide synthesis, and Dr. R. Datla for providing pRD420. The technical assistance of L. McGregor, S. Hammond, P. Hayes-Schryer, P. Mykota, W. Friesen, and R. Bacchetto is gratefully acknowledged. We also thank Drs. A. Cutler, R. Datla, and F. Georges for critical readings of the manuscript.


   NOTES
TOP
 NOTES
ABSTRACT
 INTRODUCTION
 Materials and methods
 Results and discussion
 REFERENCES
 
NRCC No. 42620.

Received for publication February 2, 1999.


   REFERENCES
TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 Materials and methods
 Results and discussion
 REFERENCES
 





This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via ISI Web of Science (7)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jain, R. K.
Right arrow Articles by Coffey, M.
Right arrow Search for Related Content
PubMed
Right arrow Articles by Jain, R. K.
Right arrow Articles by Coffey, M.
Agricola
Right arrow Articles by Jain, R. K.
Right arrow Articles by Coffey, M.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
The SCI Journals Agronomy Journal Vadose Zone Journal
Journal of Plant Registrations Soil Science Society of America Journal
Journal of Natural Resources
and Life Sciences Education		 Journal of
Environmental Quality