| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
a Dep. of Horticulture, Univ. of Wisconsin, Madison, WI 53706 USA
b Washington Univ., School of Medicine, Dep. of Biochemistry and Molecular Biophysics, St. Louis, MO 63110 USA
c Dep. of Horticulture, Univ. of Nebraska, Lincoln, NE 68583 USA
d Centro de Investigaciones Agricola del Surocate (CIAS), San Juan de la Maguana, Dominican Republic
gjung{at}facstaff.wisc.edu
 |
ABSTRACT |
|---|
 TOPNOTES ABSTRACT INTRODUCTIONMaterials and methodsResults and discussionREFERENCES |
|---|
Abbreviations: CBB, common bacterial blight • cM, centimorgan • FL, first trifoliolate leaves • GLS, gray leaf spot • GN, great northern • LDL, later developed trifoliolate leaves • LOD, log odds ratio • PCR, polymerase chain reaction • QTL, quantitative trait locus (loci) • RAPD, random amplified polymorphic DNA • RIL, recombinant inbred lines • SCAR, sequence characterized amplified regions • SSD, single seed descent • Xcp, Xanthomonas campestris pv. phaseoli
|
INTRODUCTION |
|---|
|
TOPNOTESABSTRACTINTRODUCTIONMaterials and methodsResults and discussionREFERENCES |
|---|
Previously, we constructed a RAPD marker based genetic map in common bean and used it to identify QTL associated with CBB resistance (Jung et al., 1996). The objective of the research reported here was to test those previously described candidate marker locus-QTL associations for CBB resistance in three untested genetic populations of common bean and, in addition, to analyze the original population for a third Xcp strain. We also developed a SCAR (sequence characterized amplified region) for RAPD marker BC409.1250 which was found to be significantly associated with CBB resistance in all four tested populations.
|
Materials and methods |
|---|
|
TOPNOTESABSTRACTINTRODUCTIONMaterials and methodsResults and discussionREFERENCES |
|---|
HT 7719 (Centro Internacional de Agricultura Tropical, Cali, Colombia), Venezuela 44 (Venezuela via Dominican Republic), A 55 (Centro Internacional de Agricultura Tropical, Cali, Colombia), and PC 50 (F. Saladin, Min. of Agr., Santo Domingo, Dominican Republic, 1987, unpublished data) are susceptible to Xcp and are unrelated by pedigree. BAC 6 (Brazil) is resistant to Xcp strains and is the resistance source in three of the four populations studied. BAC 6 is an inbred, selected as a transgressive segregant for higher resistance to Xcp from the cross of Carioca (susceptible to Xcp) and GN Nebraska #1 sel. 27 (late flowering, Type III plant habit, and resistant to Xcp) (Mohan and Mohan, 1983). GN Nebraska #1 sel. 27 is a single plant selection out of GN Nebraska #1 (Coyne and Schuster, 1974). Almost all plants in GN Nebraska #1 were susceptible to Xcp in the field in western Nebraska. GN Nebraska #1 (susceptible to Xcp) was derived from the interspecific cross P. vulgaris GN Montana #5 x P. acutifolius tepary bean (unknown source and resistant to Xcp) (Honma, 1956). GN Belneb RR-1 (USDA and University of Nebraska-Lincoln) derived its resistance to Xcp from GN Harris (Stavely et al., 1989). GN Harris was derived from a backcross of GN Nebraska #1 sel. 27 x GN 1140 with the former serving as the recurrent parent (Coyne et al., 1980). Some genes for resistance to Xcp in Belneb RR-1 and BAC 6 were expected to be similar.
CBB Screening
All populations were grown and inoculated in the greenhouse at Lincoln, NE. A summary of the genetic populations, Xcp strains used, and years tested is given in Table 1
. The Xcp strains were provided by Dr. Anne Vidaver, Dep. of Plant Pathology, University of Nebraska, Lincoln, NE. A randomized complete block design with two replications (two plants per replicate) was used in all inoculation experiments.
|
In 1994, 72 F9 RI lines and parents Belneb RR-1 and A 55 were inoculated with Xcp strain EK-11 in first trifoliolate leaves and pods. Greenhouse temperatures ranged between 29 ± 3°C and 23 ± 2°C day/night, and the average natural day length was 14 h during the period April to July, 1994 (Ariyarathne et al., 1999). In 1996, 128 F9 RI lines and parents BAC 6 and HT 7719 were inoculated with Xcp strain DR-7 in first trifoliolate leaves. Greenhouse temperatures ranged between 29 ± 3°C during the day and 23 ± 2°C at night, and the average natural day length was 14 h during the 1996 April to July period.
Inoculations and disease ratings for leaves and pods were performed as described by Arnaud-Santana et al. (1994). Bacterial inoculum of a final concentration of 107 colony-forming units (cfu)/mL was kept on ice in all experiments and was used for inoculations within one hour after the preparation. For all populations, the first and/or later developed trifoliolate leaves were inoculated with Xcp strains by the multiple needle method (Andrus, 1948). Necrotic, water-soaking, and chlorotic symptoms developed on the inoculated leaves. The percentage inoculated leaf area with common blight symptoms was recorded 14 d after inoculation. Pods at the seed filling stage were inoculated with the strains by the pippettman method (Arnaud-Santana et al., 1994). Water-soaked areas were visible along the pod suture or along both sides of pod walls 5 to 6 d after inoculation. The length of the lesion (mm) from the site of inoculation on the pod was measured 7 d after inoculation.
The phenotypic data were checked for deviations from normality for CBB ratings of leaves and pods by the W statistic (Shapiro and Wilk, 1965).
Molecular Marker Data and Map Construction
RAPD genetic markers were generated in the usual manner (Williams et al., 1990). Total genomic DNA was extracted from fresh fully expanded trifoliolate leaves of each line and parents of the above mentioned populations by the method previously described by Skroch and Nienhuis (1995). Polymerase chain reactions were performed in 10-µL volumes in 96 well plates in an MJ PTC-100 (MJ Research, Watertown, MA) with thermal cycling conditions described in Johns et al. (1997). Detailed information on RAPD primers and the procedures used in the naming of molecular markers was previously described by Jung et al. (1996).
Partial genetic linkage maps in each population were constructed using MAPMAKER Macintosh version 2.0 (Lander et al., 1987). The logarithm of odds (LOD) score of 3.0 as a linkage threshold and 0.3 as the maximum recombination fraction were used for linkage groups using the "Group" command. For most linkage groups, the order of the markers was determined by the "Compare" command (LOD > 3.0 and theta 0.30). Additional markers were added with the "Try" command. Then the marker order was checked with the "Ripple" command. Map distances (centimorgan, cM) were estimated using recombination fractions and Kosambi's mapping function (Kosambi, 1944) between ordered marker loci. Markers amplified by the same primer and with the same molecular weight were assumed to represent the genetic loci.
Detection and Confirmation of Marker Loci Associated with CBB Resistance
For QTL detection, the data were analyzed on the basis of one-way analysis of variance (ANOVA) and stepwise multiple regression analysis for each pairwise combination of quantitative traits and marker loci (Edwards et al., 1987). Stepwise multiple regression was performed with marker loci associated with individual QTL as independent variables to determine the best multilocus model and the total percentage of the phenotypic variance explained. Marker loci significant at the 5% probability level were included in the final model. A relatively high P value (P < 0.05) was used for detection of individual QTL and for stepwise regression analysis with the understanding that this is the pairwise Type I error, not the experimental Type I error. However, a higher type I error rate is necessary when it is desirable to reduce the probability of committing Type II errors.
For testing the marker locus-QTL associations found in the previous study (Jung et al., 1996), three genomic regions were selected to be tested in the three previously untested populations. In some instances, markers most closely associated with resistance from the previous study were monomorphic in the new populations. In these cases, polymorphic markers closely linked to the previously identified markers in the original BAC 6 x HT7719 population were used.
Cloning and Sequencing of RAPD BC409.1250
One (BC409.1250) of the RAPD markers that was significantly associated with QTL for CBB resistance in all four populations was cloned and sequenced. To convert the specific RAPD band, BC409.1250, to a SCAR marker, RAPD reaction mixtures and cycling conditions were carried out as described by Johns et al. (1997). RAPD reactions were run with a PTC-100 Programmable Thermal Cycler (MJ Research, Inc.). Amplification products were resolved electrophoretically in a 1.5% (w/v) agarose gel. The RAPD band of interest was excised and placed in a microfuge tube with 20 µL 0.1x TE. Repipetting and heating of the excised band in a water bath assisted in dissolving the agarose containing this band. A PCR reaction was run similar to the initial RAPD reaction (Johns et al., 1997) with 5 µL of the dissolved agarose band as the template. The same RAPD profile (Johns et al., 1997) was followed with the addition of a 72°C extension for 30 min at the completion of the run. Reamplification products were electrophoresed in a 1.5% (w/v) agarose gel. The reamplified RAPD band was excised and purified following the Geneclean II gel purification protocol by BIO 101 Inc. (La Jolla, CA). Ligation and transformation reactions were performed using the Original TA Cloning kit by Invitrogen Corporation (San Diego, CA). DNA sequencing was carried out with the M13 forward (-20) and the M13 reverse primers on an ABI 377XL automated DNA Sequencer at the University of Wisconsin Biotechnology Center DNA Sequencing facility (Madison, WI). For the SCAR marker, three independent RAPD bands were cloned and the resulting sequences were cross checked for matching sequence beyond the original 10-base RAPD primer sequence. PCR primers for primer specific amplification of the polymorphic fragment were designed with 21 bases from each end of the sequenced fragment including the 10 bases from the original RAPD primer. Primers were obtained from Operon Technologies Inc. (Almeda, CA). PCR reaction mixtures and cycling conditions were carried out as for RAPD reactions described by Johns et al. (1997) with an annealing temperature of 70°C instead of 42°C.
|
Results and discussion |
|---|
|
TOPNOTESABSTRACTINTRODUCTIONMaterials and methodsResults and discussionREFERENCES |
|---|
Phenotypic Data
Frequency distributions of RI and BC2F3 line means for CBB resistance measured for three Xcp strains in leaves or pods in three different genetic populations are presented in Fig. 1
.
|
|
|
|
The unmapped marker BC409.1250 was polymorphic in all four populations but remained unlinked to any other marker in these four populations (Fig. 3a) . Two linked markers, AD4.1150 and Z4.600, were mapped in two RI populations (VB and BA). Of these markers only AD4.1150 was polymorphic between the parents of the inbred backcross population (PB) (Fig. 2). However, this pair showed linkage with additional RAPD markers in the BA population. Therefore, the future expansion of the linkage map for this genomic region may be possible in the three other populations based on markers identified in the BA map.
|
Consistency of Marker Locus— QTL Associations
The unmapped marker BC409.1250 was significantly associated with CBB resistance on leaves in all four tested populations (Table 3). In the Venezuela 44 x BAC 6 population, a significant association between the marker and CBB resistance to Xcp strain EK-11 was detected but this marker was not significantly associated with CBB resistance to Xcp strain DR-7 (Table 3). Five lines, GN Harris, GN Weihing, Chase, XAN 176, and BAT 93, which are expected on the basis of their pedigree to have CBB resistance genes similar to BAC 6, also showed amplification of this marker (not shown).
One pair of linked markers, AD4.1150-Z4.600, was originally found to be significantly associated with CBB resistance in leaves in the BH population and was also confirmed in leaves or pods in two of the three other populations (Table 3). Furthermore, the pair was linked with other markers in the Belneb RR-1 x A 55 population where the most likely location of a CBB resistance QTL was at RAPD marker G17.400 (Fig. 2, Table 3). Although the most likely location of the QTL were not exactly the same across populations, the results are consistent with a single QTL for CBB resistance mapping to this genomic region.
The genomic region in linkage group 5 of the original BH population was also consistently associated with CBB resistance in leaves or pods in the BA and PB populations (Fig. 2, Table 3). However, the markers in this region were not associated with significant differences in CBB reaction to Xcp strains DR-7 and EK-11 in the VB population.
Recently, Brummer et al. (1997) reported that even though some similar QTL were detected among populations, many QTL were population specific for seed protein and oil content in eight soybean populations. No single population had more than three stable QTL, even though approximately 15 total stable QTL were identified for both seed protein and oil content. Bubeck et al. (1993) reported QTL for gray leaf spot (GLS) resistance that were different over populations with only one region associated with GLS resistance in all three tested maize (Zea mays L.) populations. Beavis et al. (1991) reported results on plant height for four maize populations and noted that no QTL could be consistently identified in all four populations. Of 14 detected QTLs, only two were detected in two different populations. Two of the populations had a common parent. Of the nine QTLs detected in these two populations, only one was detected in both.
These studies, and others (Keim et al., 1990; Beavis et al., 1991; Paterson et al., 1991) indicate wide variation in the genetic loci associated with specific quantitative traits over environments and populations. The results of the present study seem to indicate a more consistent relationship between QTL identified in different populations. However, our results cannot be compared directly with these previous studies because the QTL included in the present study were preselected on the basis of their consistency over assays in different plant organs and for different pathogen strains. Thus, although there appears to be a general consistency of CBB resistance QTL across these different populations, we did not test all previously described QTL. Furthermore, all regions of the common bean genome were not tested in all populations. If the study had included the entire bean genome, the results might have been less consistent across populations. Nevertheless, focusing on only a few important genomic regions allowed us to improve significantly our understanding of these marker locus-QTL associations for potential use in marker assisted breeding.
Many factors could have contributed to variation in the results of QTL detection experiments across populations, including the Xcp strains and plant parts assayed, and the genetic background of the parental genotypes. In addition, other factors such as genotype sampling variation and genotype x environment interaction may also result in large differences between studies.
Development of a Specific PCR Marker for RAPD BC409.1250
One genomic region, identified by RAPD marker BC409.1250, was significantly associated with CBB resistance in all four populations (Fig. 3a, Table 3). Because of the potential value of marker BC409.1250 for use as a selection tool, we converted the RAPD marker to a PCR marker based on specific primer sequences. Advantages of primer specific PCR markers over RAPDs have been discussed by Paran and Michelmore (1993) and others who have reported converting RAPD markers linked to disease resistance genes and other important traits (Melotto et al., 1996; Naqvi and Chattoo, 1996) to sequence specific PCR markers. Three clones obtained from the amplified fragment BC409.1250 were cloned and sequenced. Sequencing multiple clones may be a way to identify contaminating sequences of similar size that comigrate on gels used for separating the products of the RAPD reaction.
On the basis of the sequence data, which was identical for 200 bp at the ends of all three clones, 21 base pair SCAR (Paran and Michelmore, 1993) primers were designed for specific amplification of the BC409.1250 fragment (Fig. 3b). The sequences of the 21-mer PCR primers (5' to 3') designed for RAPD marker BC409.1250 were TAGGCGGCGGCGCACGTTTTG (BC409.1250F) and TAGGCGGCGGAAGTGGCGGTG (BC409.1250R), where the underlined sequence represents the sequence of the original RAPD primer.
The identity of the SCAR marker was verified by amplifying the marker in resistant parental lines (BAC 6 and Belneb RR-1) (Fig. 3b) and by mapping the SCAR marker in the BH population where the RAPD marker was originally described. No recombination was observed between RAPD BC409.1250 and the SCAR marker.
Implications for Bean Breeding
The determination of quantitative differences in common blight resistance in the field and greenhouse is expensive in terms of time and resources and is difficult because of low heritabilities. Thus, RAPD markers could facilitate development of CBB resistant bean varieties by providing a simple assay for selection of candidate resistant genotypes on a single plant basis in the greenhouse prior to testing in the field. Predictability of QTL expression and the genetic relationships between marker loci and QTL in different genetic backgrounds and environments is needed before information derived from linkage studies will be generally useful for marker assisted breeding. This is the first report on testing of the consistency of marker locus-QTL associations for CBB resistance in different genetic backgrounds of common bean. Our results indicate that the three genomic regions originally associated with QTL for CBB resistance in the BAC 6 x HT7719 population were also found to be associated with CBB resistance in at least two of three additional populations.
The consistency of the association of marker BC409.1250 with CBB resistance across populations and the apparent uniqueness of the amplified fragment strongly suggests that this marker can be used effectively for marker assisted selection of CBB resistance. Importantly, this genomic region was associated with resistance to all three tested Xcp strains. Therefore, the CBB resistance QTL associated with BC409.1250 may be very useful for breeding cultivars with a broad range of resistance and combining it with other sources of CBB resistance via marker-assisted backcrossing to provide more stable resistance to Xcp. Discovery of additional markers linked to BC409.1250 will be necessary in populations not polymorphic for BC409.1250, and to provide the opportunity for selection based on flanking markers. BC409.1250 has currently not been linked to any other markers. The development of a sequence specific PCR-based marker for this RAPD provides a marker with greater reproducibility that can be used more efficiently on a large scale.
Further research may be needed to determine how these QTL will behave in different field environments. For example, large differences in temperature, photoperiod, soil type, and biotic pressures occur in temperate (Nebraska) versus tropical environments such as in the Dominican Republic. Future isogenic line analysis of these QTL can be used to determine more precisely the recombination distance between genes for partial resistance to CBB and marker loci.
|
ACKNOWLEDGMENTS |
|---|
|
NOTES |
|---|
|
TOPNOTESABSTRACTINTRODUCTIONMaterials and methodsResults and discussionREFERENCES |
|---|
Received for publication August 13, 1998.
|
REFERENCES |
|---|
|
TOPNOTESABSTRACTINTRODUCTIONMaterials and methodsResults and discussionREFERENCES |
|---|
This article has been cited by other articles:
|
|
 |
|
  S. H. Guzman-Maldonado, O. Martinez, J. A. Acosta-Gallegos, F. Guevara-Lara, and O. Paredes-Lopez Putative Quantitative Trait Loci for Physical and Chemical Components of Common Bean Crop Sci., May 1, 2003; 43(3): 1029 - 1035. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. A. Scheef, M. D. Casler, and G. Jung Development of Species-Specific SCAR Markers in Bentgrass Crop Sci., January 1, 2003; 43(1): 345 - 349. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Tar'an, T. E. Michaels, and K. P. Pauls Genetic Mapping of Agronomic Traits in Common Bean Crop Sci., March 1, 2002; 42(2): 544 - 556. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Schneider, K. F. Grafton, and J. D. Kelly QTL Analysis of Resistance to Fusarium Root Rot in Bean Crop Sci., March 1, 2001; 41(2): 535 - 542. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| The SCI Journals | Agronomy Journal | Vadose Zone Journal | |||
| Journal of Natural Resources and Life Sciences Education |
Soil Science Society of America Journal | ||||
| Journal of Plant Registrations | Journal of Environmental Quality |
The Plant Genome | |||
