HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text Free Full Text (PDF) Free Alert me when this article is cited Alert me if a correction is posted Services Similar articles in this journal Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via Google Scholar Google Scholar Articles by Luciani, G. Articles by Wofford, D. Search for Related Content PubMed Articles by Luciani, G. Articles by Wofford, D. Agricola Articles by Luciani, G. Articles by Wofford, D. Related Collections Insect Resistance Cell Biology & Molecular Genetics Crop Genetics

Expression of cry1Fa in Bahiagrass Enhances Resistance to Fall Armyworm

^a Univ. of Florida-IFAS, Agronomy Dep., Genetics Institute, Plant Molecular and Cellular Biology Program, PO Box 110300, Gainesville, FL 32611
^b USDA, ARS, CMAVE, Gainesville, FL 32608-1069

View larger version (21K): [in this window] [in a new window]   Figure 1. Expression cassettes used for the generation of transgenic bahiagrass by biolistic gene transfer. Schematic representation of the minimal expression cassettes for nptII (2554 bp) excised from vector pHZ35SNPTII (top) and the synthetic cry1Fa gene (4155 bp) excised from vector pHZCRY (bottom).

View larger version (64K): [in this window] [in a new window]   Figure 2. Polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT–PCR), and Southern blot analysis of cry1Fa in bahiagrass. (A) A 570-bp fragment was amplified by PCR from genomic DNA of transgenic bahiagrass lines (1, 2, and 3) in comparison to wild-type (WT), buffer (NC), and pHZCRY plasmid DNA (PC) using the cry1Fa specific forward 5'ATGGTTTCAACAGGGCTGAG3' and reverse 5'CCTTCACCAAGGGAATCTGA3' primers. (M) lambda HindIII marker. (B) The presence of the cry1Fa transcripts following RT–PCR of bahiagrass lines (1, 2, and 3) in comparison to WT plasmid, NC, and PC using the cry1Fa specific primers as described above. (M) lambda HindIII marker. (C) Southern blot of genomic DNA from transgenic bahiagrass lines (1, 2, and 3), WT bahiagrass and 20 pg PC following hybridization with a radio-labeled probe of the complete cry1Fa coding sequence.

View larger version (23K): [in this window] [in a new window]   Figure 3. Cry1Fa protein expression in leaves of transgenic bahiagrass lines and wild type. (A) Immuno-chromothographic (cry1Fa Quickstix, Envirologix) evaluation of protein extracts of transgenic bahiagrass (1, 2, and 3) or wild type (WT). The arrow indicates the diagnostic band. (B) Optical densitometry at 450 nm (OD450) values of Cry1Fa enzyme linked immunosorbent assay (ELISA) of protein extracts from transgenic bahiagrass lines (1,2, and 3) and wild-type bahiagrass (WT), on an average of triplicate analysis of three independent vegetative clones. Bars represent standard error. Letters indicate differences at P < 0.05 by Tukey test.

View larger version (50K): [in this window] [in a new window]   Figure 4. Insect bioassays with fall armyworm neonate larvae feeding on leaves from transgenic bahiagrass lines and wild-type bahiagrass. (A) Feeding pattern of neonate larvae on leaves of transgenic bahiagrass lines (1, 2, and 3) and wild-type (WT) bahiagrass. (B) Survival rate (%) of neonate fall armyworm larvae following feeding on transgenic bahiagrass leaves (lines 1, 2, and 3) and WT bahiagrass. Bars represent standard error. Letters indicate differences at P < 0.05 by LSD protected test.