
View larger version (64K):
[in this window]
[in a new window]
|
Figure 2. Polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT–PCR), and Southern blot analysis of cry1Fa in bahiagrass. (A) A 570-bp fragment was amplified by PCR from genomic DNA of transgenic bahiagrass lines (1, 2, and 3) in comparison to wild-type (WT), buffer (NC), and pHZCRY plasmid DNA (PC) using the cry1Fa specific forward 5'ATGGTTTCAACAGGGCTGAG3' and reverse 5'CCTTCACCAAGGGAATCTGA3' primers. (M) lambda HindIII marker. (B) The presence of the cry1Fa transcripts following RT–PCR of bahiagrass lines (1, 2, and 3) in comparison to WT plasmid, NC, and PC using the cry1Fa specific primers as described above. (M) lambda HindIII marker. (C) Southern blot of genomic DNA from transgenic bahiagrass lines (1, 2, and 3), WT bahiagrass and 20 pg PC following hybridization with a radio-labeled probe of the complete cry1Fa coding sequence.
|